大阪府立大学　学術情報リポジトリ

Pathological studies on the cell

characteristics and roles of glial cells in

myelin mutant rats

著者

Izawa Takeshi

内容記述

学位授与大学: Osaka Prefecture University(大阪

府立大学), 学位の種類: 博士(獣医学), 学位記番

号: 論獣第140号, 学位授与年月日: 2010-03-31,

指導教員: 山手丈至.

大阪府立大学博士（獣医学）学位論文

Pathological studies on the cell characteristics and roles of

glial cells in myelin mutant rats

（ミエリン疾患ミュータントラットにおける

グリア細胞の特性と役割に関する病理学的研究）

井澤 武史

Contents

Preface... 1

Chapter 1 Glial pathology during development of hypomyelination in the myelin vacuolation (mv) rat... 6

Section 1-1. Analysis of glial pathology in the spinal cord of the mv rat ...7 ...

Introduction 7

...

Materials and Methods 8

... Results 10 ... Discussion 11 ... Summary 14 ... Figure Legends 15 ... Plate I 17 ... Section 1-2. Identification of attractin-expressing cells in the normal spinal cord 20

...

Introduction 20

...

Materials and Methods 21

... Results 22 ... Discussion 23 ... Summary 24 ... Figure Legends 25 ... Plate II 26

Chapter 2 Microglial activation and gray matter lesions in the mv rat... 27

Section 2-1. Analysis of expression patterns of microglia-related factors in the mv rat ...28 ...

Introduction 28

...

Materials and Methods 29

... Results 31 ... Discussion 31 ... Summary 34

... Table 1 35 ... Figure Legends 36 ... Plate III 37

Section 2-2. Analysis of expression patterns of myelin proteins in the mv rat ...38 ...

Introduction 38

...

Materials and Methods 39

... Results 42 ... Discussion 45 ... Summary 48 ... Tables 2, 3 49 ... Figure Legends 50 ... Plate IV 53

Chapter 3 Iron metabolism in the two different myelin mutant rats... 57 ...

Introduction 58

...

Materials and Methods 59

... Results 61 ... Discussion 63 ... Summary 66 ... Table 4 67 ... Figure Legends 68 ... Plate V 71 Conclusions... 76 References... 78 Acknowledgements... 97

Preface

The rapid saltatory conduction along vertebrate axons requires the formation of

insulating myelin sheaths, which are formed by oligodendrocytes in the central nervous

system (CNS) and Schwann cells in the peripheral nervous system (PNS). Myelin diseases are

a heterogenous group of neurological diseases in which myelin structure is primarily affected.

Primary diseases of CNS myelin in humans are devided into the two major types: 1)

demyelination (myelin breakdown after it is formed) such as multiple sclerosis (MS) and

acute disseminated encephalomyelitis, 2) dysmyelination/hypomyelination (failure to form

normal amount of myelin during development) such as adrenoleukodystrophy and

Pelizaeus-Merzbacher disease (Powers, 2004). The causes of myelin diseases are various (e.g.,

hereditary, immune-mediated, infectious and metabolic) and there are many clinical

phenotypes even in one myelin disease. Because of this heterogeneity, the pathogenesis of

human myelin diseases is still obscure. Therefore, suitable animal models are needed to

elucidate the mechanism of disease processes.

In experimental animals such as mice and rats, various mutant models with CNS

myelin disorders have been reported ("myelin mutants"). These myelin mutants are largely

devided into two types according to their mutated genes. The first are mutants deficient in

myelin-constituting proteins, such as the shiverer (shi) mouse, jimpy (jp) mouse, myelin

deficient (md) rat and Long Evans shaker (les) rat (Baumann and Pham-Dinh, 2001). Myelin

abnormalities of these mutants are mainly due to structural defects of myelin sheaths. The

second are mutants with defects in proteins that are not structural components of myelin but

responsible for the formation and/or maintenance of myelin, such as the tremor rat (Kitada et

al., 2000) and taiep (tremor, ataxia, immobility, epilepsy and paralysis) rat (Li et al., 2003;

pathogenesis of myelin diseases in this type of mutants. Myelin mutants can be suitable

models for studying the cellular and molecular mechanisms of myelination and maintenance

of myelin.

Homeostasis of the central nervous system is maintained by a balanced interaction

between glial cells, which constitute the great majority of cells in the nervous system (65%

and 90% in rodents and humans, respectively) (Baumann and Pham-Dinh, 2001).

Oligodendrocytes are the myelin-forming cells of the CNS and thus seem to be primarily

affected in the myelin diseases. Extensive loss of oligodendrocytes is a hallmark of MS, an

autoimmune demyelinating disease in humans (Lassmann, 2004a), whereas it is much less

severe in experimental autoimmune encephalomyelitis (EAE), an animal model of MS

(Lassmann, 2004b). Astrocytes are the supporting cells in the CNS and mainly involved in the

maintenance of tissue homeostasis. In MS and EAE, astrocytes play a protective role in

demyelination by releasing anti-inflammatory cytokines such as interleukin (IL)-4 and IL-10,

and cytokines that promote oligodendrogenesis such as insulin-like growth factor-1 and

leukemia inhibitory factor, whereas they also play a destructive role by producing

inflammatory cytokines such as IL-12 and IL-23, and by forming the glial scar, a physical

barrier for myelin repair (Nair et al., 2008). Microglia are the CNS-resident macrophages and

involved in immune functions and the clearance of tissue debris. Activated microglia in

demyelinating lesions release proinflammatory cytokines such as tumor necrosis factor-α

(TNF-α) and IL-1β, and reactive oxygen and nitrogen species, all of which are detrimental to

myelin (Jack et al., 2005; Raivich and Banati, 2004). These findings suggest that not only

oligodendrocytes but also astrocytes and microglia play crucial roles in the pathogenesis of

myelin diseases.

It is well known that iron is enriched in the CNS and is essential for its normal

oligodendrocytes are the principal cells that contain a high amount of iron in the CNS,

suggesting functional relationship between iron accumulation and myelin production

(MacKenzie et al., 2008; Meguro et al., 2008; Todorich et al., 2009). In humans, iron

deficiency is the most common nutritional disorder in the world, and the affected children

suffer from neurological deficits in addition to anemia (Beard, 2008; Lozoff et al., 2006). The

most common neurological signs are poor school performance, decreased cognitive abilities

and behavior problems, which are likely to be consistent with alterations in myelination and

neurotransmitter functions. Studies using rat models of iron deficiency demonstrated that

restriction of dietary iron during gestation and early postnatal period results in

hypomyelination with a decrease in myelin proteins, lipids and cholesterol in the CNS

(Todorich et al., 2009). These findings suggest that iron acquisition during prenatal and

postnatal period is necessary for normal CNS myelination.

Besides iron deficiency, abnormal accumulation of iron is considered to be involved in

the pathogenesis of myelin diseases. Histochemical studies revealed that abnormal iron

deposits are observed in infiltrating macrophages/reactive microglia, axons/neurons and

oligodendrocytes in MS patients (LeVine, 1997; Levine and Chakrabarty, 2004). In mice with

EAE, the iron deposits are detected in macrophages and astrocytes (Forge et al., 1998). These

data suggest that glial cells may participate in altered iron metabolism of demyelinating

diseases.

The myelin vacuolation (mv) rat is an autosomal recessive mutant characterized by

hypomyelination and vacuole formation in the myelin throughout the CNS, which is caused

by a null mutation in the attractin (Atrn) gene on rat chromosome 3 (Kuwamura et al., 2002).

ATRN was first discovered as a secreted serum glycoprotein, released by activated T cells

with a role in chemotaxis regulation in humans (Duke-Cohan et al., 1995, 1998). The Atrn

(Kuramoto et al., 2001; Tang et al., 2000), whereas only transmembrane form has been found

in mice (Gunn et al., 1999). Atrn mRNA is widely expressed in various organs (Gunn et al.,

1999; Tang et al., 2000), and ATRN protein has multiple biological functions including

immune cell interaction, hair pigmentation, energy homeostasis, and CNS myelination

(Dinulescu et al., 1998; Duke-Cohan et al., 2000; He et al., 2001; Kuramoto et al., 2001;

Nagle et al., 1999). Mutations in the Atrn gene have been reported in mice (mahogany,

Atrnmg_{), rats (zitter, Atrn}zi_{; myelin vacuolation, Atrn}mv_{) and Syrian hamsters (black tremor,}

Atrnbt_{) (Gunn et al., 1999; Kuramoto et al., 2001, 2002); all of these mutations result in}

abnormal hair pigmentation and vacuole formation in the CNS (Gunn et al., 2001; Nunoya et

al., 1985; Rehm et al., 1982). However, the detailed glial pathology during development of

myelin disorders in the Atrn mutant animals has not been investigated to date.

The demyelination (dmy) rat is an autosomal recessive mutant which exhibits hind

limb ataxia and severe myelin breakdown in the CNS during the late stage of postnatal

myelination (Kuwamura et al., 2004). Genetic analysis revealed that the dmy locus is located

on rat chromosome 17, homologous to human chromosome 6 and mouse chromosome 13

(Kuramoto et al., 1996). To date, no myelin-related gene has been reported in the homologous

regions of humans or mice, suggesting that the dmy rat is a novel myelin mutant.

Immunohistochemical and morphometrical studies have been reported in the dmy rat

(Kuwamura et al., 2004), however, the exact pathogenesis of demyelination remains to be

elucidated.

In this thesis, the cellular and molecular changes of glial cells during development of

myelin disease were investigated in the hypomyelinating mutant mv and demyelinating

mutant dmy rats. In the first chapter, for understanding the pathogenesis of hypomyelination in

the mv rat, glial cell kinetics were investigated in the mv rat, and the Atrn-expressing cells in

microglia-related factors and myelin-constituting proteins were examined to determine the

relationship between microglial activation and myelin alterations in the gray matter of the mv

rat. In the last chapter (chapter 3), changes in iron metabolism and expression of iron

regulatory proteins in the mv and dmy rats were investigated for understanding the role of iron

Chapter 1

Glial pathology during development of hypomyelination

in the myelin vacuolation (mv) rat

Section 1-1. Analysis of glial pathology in the spinal cord of the mv rat

Introduction

It is well known that glial abnormalities are critically involved in the pathogenesis of

myelin mutant animals. Premature cell death of oligodendrocytes accounts for a severe CNS

myelin deficit in the jimpy mouse, a myelin mutant with a X-linked mutation in the

proteolipid protein (PLP) /DM20 gene (Skoff, 1976; Knapp et al., 1986). Unlike the jimpy,

functional abnormalities of oligodendrocytes are responsible for the myelin alterations in the

les and taiep rats, which are characterized by dysmyelination with an insertional mutation in

the myelin basic protein (MBP) gene (Delaney et al., 1995; Kwiecien et al., 1998; O’Connor

et al., 1999), and by early hypomyelination and subsequent demyelination associated with

microtubule alterations in oligodendrocytes (Duncan et al., 1992; Holmgren et al., 1989;

Lunn et al., 1997; Song et al., 1999), respectively.

Besides oligodendrocyte abnormalities, changes in astrocytes and microglia are

commonly observed in the myelin mutants. The jimpy mutant mice show a striking

hypertrophy of astrocytes (Omlin and Anders, 1983; Skoff, 1976) and an intense microglial

reaction that is more pronounced in the white matter than in the gray matter and is related to

apoptotic oligodendrocytes (Vela et al., 1995 and 1996). In the les rat, astrogliosis and

microgliosis are localized to the white matter (Kwiecien et al., 1998; Zhang et al., 2001). In

the taiep rat, progressive astrogliosis is developed in the brain lesions where hypomyelination

is more prominent (Leon Chavez et al., 2001), and the number of CD11b-positive microglia/

macrophages is increased in the cerebellar white matter (Leon Chavez et al., 2006). The

pattern and degree of glial abnormalities vary in each mutant, but are closely associated with

In this section, glial changes during development of hypomyelination in the spinal

cord of the mv rat were investigated.

Materials and Methods

Animals

The mv rats were bred and maintained in a mixed background of Sprague-Dawley

and Donryu. Homozygous mv (mv/mv) rats were obtained by mating heterozygous (mv/+)

females with heterozygous males. The genotype of each rat was determined by polymerase

chain reaction (PCR) using diagnostic primer sets (Tokuda et al., 2004). Rats were maintained

in a room with controlled temperature and 12-hour light-dark cycle. Food and water were

provided ad libitum. Rats were handled according to the Guidelines for Animal

Experimentation of Osaka Prefecture University.

Histology and Immunohistochemistry

For histological analysis, control (+/+ or mv/+) and mv homozygous (mv/mv) rats at

2, 4, 6, and 10 weeks of age were deeply anesthetized and perfused transcardially with 4%

paraformaldehyde (PFA) in 0.1 M phosphate buffer (PB; pH 7.4). Removed lumbar spinal

cords were stored in 2% PFA and 2.5% glutaraldehyde in 0.1 M PB, postfixed with 1% osmic

acid for 2 h, and embedded in epoxy resin. One μm semi-thin sections were cut and stained

with toluidine blue. Ultrathin sections were stained with uranyl acetate and lead citrate and

examined in a Hitachi H-7500 electron microscope (Hitachi, Japan). For

transcardially with 4% PFA in 0.1 M PB. Lumbar spinal cords were then removed and

postfixed in 4% PFA in 0.1 M PB at 4°C overnight. After 2- or 3-day treatment with 30%

sucrose in phosphate-buffered saline (PBS) at 4°C, spinal cords were transversely sliced and

frozen at –80°C. Ten μm frozen sections were cut using a cryostat. The following primary

antibodies were used: mouse anti-2', 3'-cyclic nucleotide-3'-phosphodiesterase (CNP) for

oligodendrocytes (1:1,000; Sigma, USA), rabbit anti-glial fibrillary acidic protein (GFAP;

1:1,000; Dako, Denmark) for astrocytes, mouse anti-CD11b (clone OX-42; 1:200; Millipore,

USA) for microglia/macrophages, and mouse anti-MHC class II (rat RT-1B; clone OX-6;

1:100; Serotec, UK) for activated microglia/macrophages. Horseradish peroxidase-conjugated

secondary antibody (Histofine simplestain MAX PO; Nichirei, Japan) was used for GFAP,

CD11b and MHC class II immunohistochemistry, while the avidin-biotinylated enzyme

complex Kit (Vector Laboratories, USA) was used for CNP immunohistochemistry. Signals

were visualized with 3,3-diaminobenzidine (DAB) substrate kit (Vector Laboratories).

Cell counts

The number of CNP-positive oligodendrocytes was counted in the whole dorsal

funiculus of 10-μm transverse sections of the lumbar spinal cord under microscopic

observation. Three different fields from three different animals were evaluated. The sections

were scanned by a digital camera (Coolpix990; Nikon, Japan), and the area of the dorsal

funiculus was measured using a software (WinRoof; Mitani Corporation, Japan). The data are

presented as the number of CNP-positive cells/mm2_.

Data are presented as means ± SD. Statistical analysis was performed using one-way

analysis of variance followed by Tukey’s test or Scheffe’s test. A value of P less than 0.05 was

considered statistically significant.

Results

Myelin abnormalities increase within spinal cord white and gray matter during postnatal development

To understand the progression of myelin pathology in the mv rat, the temporal

changes in the myelin during postnatal development of the spinal cord were examined.

Compared with age-matched control rats (Fig. 1A-C), fewer myelinated axons and thinner

myelin sheaths were observed in the white matter of the mv rats (Fig. 1D-F). This

hypomyelination became more prominent with age. Also present in the mv rats were

variously-sized vacuoles and abnormal myelin sheaths (Fig. 1F, arrows), which were

frequently observed in the white matter from 6 weeks. In the gray matter, fewer myelinated

axons and vacuolated myelin sheaths (Fig. 2B, arrows) were observed in the mv rats from 6

weeks. In electron microscopy, naked and hypomyelinated axons were observed in the mv rats

(Fig. 3, arrows and arrowheads, respectively), whereas no obvious ultrastructural abnormality

was found in oligodendrocytes (Fig. 3).

Myelin pathology is associated with increased astrogliosis but no changes in oligodendrocyte numbers or morphology, while microglial activation is mainly confined to the gray matter

with specific glial markers. There were no apparent changes in the morphology of

CNP-positive oligodendrocytes between control and mv rats at any of the ages examined (Fig. 4B,

C), neither did the number of CNP-positive oligodendrocytes differ significantly (Fig. 4A).

Compared with control rats (Fig. 5A, B), GFAP immunoreactivity in the white matter of the

spinal cord was increased in the mv rats from 2 weeks (Fig. 5E) and was more pronounced at

8 weeks (Fig. 5F). In the gray matter, the morphology of astrocytes was almost similar both in

control and mv rats at 2 weeks (Fig. 5C, G), but at 8 weeks the astrocytes in the mv rats

showed hypertrophy of their processes, a common feature of activated astrocytes (Fig. 5H,

arrows). Microglial morphology in the white matter of the mv rats was almost similar to

controls at all ages (Fig. 6A, D). In the gray matter, the morphology of microglia was not

prominently changed either in control and mv rats up to 4 weeks, but from 6 weeks the

microglia in the mv rats had an activated morphology, characterized by swollen cell bodies

and shortened processes (Fig. 6E). Furthermore, MHC class II immunohistochemistry

revealed marked microglial activation in the mv rats from 6 weeks, which was exclusively

found in the gray matter (Fig. 6F).

Discussion

In the mv rat, hypomyelination and abnormal myelination were observed in the white

matter of the spinal cord from 2 weeks, the severity of which progressed with age. Despite

progressive myelin pathology, the number and morphology of oligodendrocytes in the mv rat

were almost similar to those in controls at all ages examined. In the jimpy mouse,

oligodendrocytes proliferate but die rapidly through apoptosis (Knapp et al., 1986), which

may result from the accumulation of misfolded PLP in the endoplasmic reticulum (Gow et al.,

life and increase with age, whereas CNS myelin is gradually lost, indicating an inability of

oligodendrocytes to maintain myelin (Kwiecien et al., 1998). The les rat also has an abnormal

accumulation of vesicular organelles in the cytoplasm of oligodendrocytes, which may reflect

a failure of myelin production and formation. In the taiep rat, the myelin deficit has been

directly associated with microtubule alterations in oligodendrocytes (Song et al, 1999), and

with alterations in the expression and intracellular distribution of myelin gene products

(O’Connor et al., 2000). In the mv rat, no degenerating oligodendrocytes were seen under

light microscope, and no ultrastructural abnormality of oligodendrocytes was observed. The

results of this study show that oligodendrocytes in the mv rat do not undergo direct cell injury

or death, but may have some dysfunction in formation and maintenance of CNS myelin.

The results of this study showed increased GFAP immunoreactivity in the white

matter of the spinal cord in the mv rat from 2 weeks, which progressed with age. Hypertrophic

astrocytes also appeared in the gray matter of the mv rat from 6 weeks. The regional and

temporal patterns of astrocyte activation are consistent with those of myelin alterations in the

mv rat, and these astrocytic changes are commonly observed in myelin mutants. In the les rat,

the temporal pattern of astrocyte hypertrophy corresponds to that of dysmyelination, and the

distribution of reactive astrocytes is dominant in the white matter, indicating an astrocyte

response to the white matter lesions (Zhang et al., 2001). Similarly, the progressive

astrogliosis is considered as a reactive change in the taiep rat, since the regional and temporal

patterns correlate with the process of dysmyelination (Leon Chavez et al., 2001). Unlike the

les and taiep rats, astrocyte abnormalities in the jimpy mouse are observed not only during

myelination but also in early postnatal development, before mature oligodendrocytes appear,

supporting but not proving a causative effect of astrocytes on myelin deficit (Omlin and

Anders, 1983; Skoff, 1976). The results of this study demonstrate that the progressive

reactive changes of astrocytes to the myelin alterations.

CD11b and MHC class II immunohistochemistry demonstrated the presence of

numerous activated microglia in the gray matter of the spinal cord in the mv rat from 6 weeks.

The time course of microglial activation was consistent with the progression of myelin

pathology, whereas the distribution of activated microglia did not match with the myelin

lesions that were predominant in the white matter. This distribution was clearly different from

other myelin mutants such as the jimpy mouse (Vela et al., 1995 and 1996), les rat (Zhang et

al., 2001) and taiep rat (Leon Chavez et al., 2006), where the microglial reaction is limited to

the white matter. Despite the numerous activated microglia in the gray matter, there were no

phagocytic microglia or degenerating neurons in the mv rat, indicating that the microglial

activation in this mutant is unlikely to be a mere reaction to myelin disruption or neural

degeneration. Further study is required to determine why microglial activation is limited to

Summary

Glial pathology during the development of hypomyelination in the spinal cord of the

mv rat was investigated. The severity and extent of myelin disorder increased during postnatal

myelination in the mv rat, whereas no abnormality was found in the number or morphology of

oligodendrocytes at any of the ages examined. Coincident with the myelin abnormalities,

there was progressive astrogliosis both in the white and gray matter of the mv rat from 2

weeks. Marked microglial activation was mainly confined to the gray matter of the mv rat

from 6 weeks, which was consistent temporally but not spatially with the morphological

abnormalities of myelin sheaths. The glial abnormalities in the mv rat were closely associated

with the myelin lesions, suggesting that, like other myelin mutants, glial cells are involved in

Figure Legends

Fig. 1

Toluidine blue-stained sections of the white matter (ventral funiculus) of the lumbar spinal

cord in control (A-C) and mv (D-F) rats. Compared with control rats (A-C), fewer myelinated

axons and thinner myelin sheaths are found in the mv rats (D-F). From 6 weeks, abnormal

myelin sheaths are frequently observed in the mv rats (F, arrows). Bar: 20 μm.

Fig. 2

Toluidine blue-stained sections of the gray matter of the lumbar spinal cord in control (A) and

mv (B) rats at 6 weeks. The number of myelinated fibers are markedly decreased in the mv

rats (B) compared with control rats (A). Vacuolated myelin sheaths are frequently observed in

the mv rats (B, arrows). Bar: 20 μm.

Fig. 3

Electron micrograph of the white matter of the lumbar spinal cord of the mv rat at 6 weeks.

There are many unmyelinated (arrows) or thinly-myelinated axons (arrowheads), whereas

no ultrastructural abnormality is found in oligodendrocytes. Bar: 1.4 μm.

Fig. 4

The graph represents the number of CNP-positive oligodendrocytes in the dorsal funiculus of

the lumbar spinal cord (A). Data are presented as the number of positive cells/mm2 _{(n=3 in}

each group). CNP immunohistochemistry in the white matter of the lumbar spinal cord in

control (B) and mv rats (C). There are no significant differences in the cell number or

Fig. 5

GFAP immunohistochemistry in the lumbar spinal cord of control (A-D) and mv (E-H) rats.

Compared with control rats (A, B), immunoreactivity for GFAP is increased in the white

matter of mv rats from 2 weeks (E, F). Hypertrophic astrocytes (arrows) are found in the gray

matter of the mv rats at 8 weeks (H). Bar: 40 μm.

Fig. 6

Immunohistochemistry for CD11b (A, B, D, E) and MHC class II (C, F) in the lumbar spinal

cord of control (A-C) and mv (D-F) rats at 6 weeks. There are no apparent morphological

changes of microglia in the white matter of the mv rats (D), whereas there are many activated

microglia with swollen cell bodies in the gray matter of the mv rats (E). MHC class II

immunohistochemistry shows that microglial activation is confined to the gray matter of the

Plate I

Fig. 1

F

E

D

C

B

2 wks

4 wks

6 wks

A

control

mv

Fig. 2

A

B

Fig. 3

Fig. 4

A

Fig. 5

A

G

F

E

C

B

D

H

control

mv

2 wks

8 wks

2 wks

8 wks

white matter

gray matter

Fig. 6

F

C

E

D

B

white matter

MHC class II

A

control

mv

gray matter

CD11b

Section 1-2. Identification of attractin-expressing cells

in the normal spinal cord

Introduction

It was demonstrated in the previous section that the Atrn defect does not affect

oligodendrocyte numbers and morphology, however results in progressive myelin vacuolation

in the spinal cord, implying a functional abnormality of oligodendrocytes in myelin

formation.

A transgenic rescue experiment revealed that membrane-type but not secreted-type

Atrn complemented neurological alteration in the Atrn mutant zitter rat, indicating a critical

role of membrane-type Atrn in normal myelination and myelin maintenance in the CNS

(Kuramoto et al., 2001). An in situ hybridization analysis demonstrated a broad distribution of

Atrn mRNA throughout the CNS of normal adult rats (Lu et al., 1999). However, in that study

the cell type expressing Atrn was not identified, and the distribution of Atrn was not examined

in young rats. Since myelin abnormalities in the mv rat are observed from 2 weeks of age, an

early stage of postnatal myelination, analysis for the Atrn expression should be performed

using rats at early myelination.

Therefore in this section, the expression of Atrn mRNA during early postnatal

development of normal rat spinal cord was investigated for exploring the role of Atrn in

Materials and Methods

Preparation of digoxigenin (DIG)-labeled riboprobe

For riboprobe preparation, a 788-bp fragment of exon 29 of rat membrane-type Atrn

(GenBank accession no. AB038387) was amplified by PCR (sense primer, 5’-GGC TCC CAC

CTA CCT GTT TAT G-3’, nucleotide position 6454-6475; antisense primer, 5’-TTT GCC

TGT TCG TGC TGT G -3’, nucleotide position 7223-7241). The PCR product was subcloned

into pGEM T-easy vector (Promega, USA). DIG-labeled antisense or sense riboprobe was

synthesized with T7 or SP6 RNA polymerase (Roche, Switzerland), respectively.

In situ hybridization for Atrn

Lumbar spinal cords of wild-type and mv rats at 2 and 4 weeks were sampled as

previously described (see Section 1-1, Materials and Methods). Ten-μm frozen sections were

cut using a cryostat. Before hybridization, sections were pretreated as follows: 1) 4% PFA in

PBS for 15 min, 2) 10 μg/ml proteinase K (Invitrogen, USA) at 37°C for 12 min, 3) 0.2 M

HCl for 10 min, 4) 0.25% acetic anhydride in 0.2 M triethanolamine (pH 8.0) for 10 min.

DIG-labeled riboprobes were diluted in hybridization buffer (50% formamide, 10 mM

Tris-HCl, pH 8.0, 200 μg/ml yeast tRNA, 10% dextran sulfate, 1×Denhardt’s solution, 600 mM

NaCl, 0.25% SDS, 1 mM EDTA), and were placed on each slide. Sections were then

coverslipped and incubated at 65°C for 16 h. After hybridization, they were rinsed in

2×sodium saline citrate (SSC) containing 50% formamide at 65°C for 30 min, treated with 20

μg/ml RNase A (Roche) at 37°C for 30 min, and rinsed in 2×SSC, 0.2×SSC, and 0.1×SSC

phosphatase-conjugated anti-DIG antibody (Roche) at 4°C overnight and were visualized with

5-bromo-4-chloro-3-indolyl phosphate (BCIP) and nitro blue tetrazolium chloride (NBT) substrates

(Roche).

Identification of Atrn-expressing cells

For double labeling, immunohistochemistry was performed following in situ

hybridization. RNA hybrids were visualized with 2-hydroxy-3-naphthoic acid-2-phenylanilide

phosphate (HNPP)/Fast Red TR (Roche). Sections were then incubated with mouse anti-CNP

(Millipore) and rabbit anti-GFAP (Dako) antibody and reacted with fluorescein isothiocyanate

(FITC)-conjugated secondary antibodies (Jackson Immunoresearch, USA). Signals were

detected with a confocal imaging system (C1Si; Nikon) .

Results

Atrn mRNA is mainly expressed by CNP-positive oligodendrocytes in the white matter

To explore the role of Atrn in the normal rat spinal cord, Atrn-expressing cells was

investigated by in situ hybridization using DIG-labeled riboprobe specific to the

membrane-type Atrn mRNA. Atrn antisense probe labeled a large number of positive cells both in the

white and gray matter of wild-type spinal cord at 2 weeks (Fig. 7A, D), whereas there was no

labeling with the sense probe (Fig. 7B, E). No specific signal was detected in the mv rats with

the antisense probe (Fig. 7C, F). For identification of Atrn-expressing cells, double labeling

by in situ hybridization and immunohistochemistry was performed. Atrn mRNA was

arrowheads). In the gray matter, GFAP-positive astrocytes were occasionally positive for Atrn

(Fig. 8D-F; arrow). Some neurons were also positive for Atrn in the gray matter (Data not

shown).

Discussion

The results of this study revealed that Atrn mRNA is mainly expressed by oligodendrocytes in the spinal cord white matter of wild-type rats at early postnatal ages,

which suggests that the membrane-type Atrn is involved in oligodendrocyte function.

Recently, a biochemical study showed the progressive loss of lipid-raft domains and reduction

in cellular cholesterol in splenocytes of the Atrn-deficient mouse, proposing that the

juvenile-onset hypomyelination and neurodegeneration represent a defect in attractin-mediated

raft-dependent myelin biogenesis (Azouz et al., 2007). Lipid rafts are detergent-insoluble

glycolipid-enriched membrane microdomains that participate in protein sorting and trafficking

(Simons and Ikonen, 1997) and may take a critical role in forming the myelin membrane

(Simons et al., 2000). Together with these findings, the results of this study show that Atrn

may be directly involved in the function of oligodendrocytes in postnatal myelination.

Recently, Nakadate et al. (2008) investigated ATRN expression in the mouse and rat

CNS at 8 weeks using a specific antibody against the membrane-type ATRN. ATRN is widely

expressed by neurons, microglia, astrocytes and oligodendrocytes, and localized in the

cytoplasmic membrane of Golgi apparatus, endoplasmic reticulum and mitochondria of

neurons and glial cells. The broad cellular and subcellular localization of ATRN suggests that

ATRN may serve multiple functions in the CNS. Further study is needed to determine the role

of ATRN in CNS myelination and the relationship between oligodendrocytes and other cell

Summary

The expression of Atrn mRNA in the spinal cord of normal rats at early postnatal ages

was investigated. Atrn expression was widely distributed both in the white and gray matter of

the spinal cord in wild-type rats, whereas no signal was detected in mv rats. In situ

hybridization combined with immunohistochemistry revealed that Atrn mRNA is mainly

expressed by mature oligodendrocytes in the white matter, and also by astrocytes and neurons

in the gray matter of normal spinal cord. These data suggest an important role of Atrn in

Figure Legends

Fig. 7

In situ hybridization for Atrn mRNA in the lumbar spinal cord of wild-type (A, B, D, E) and mv (C, F) rats. A large number of Atrn-positive cells are labeled with the antisense probe both

in the white (A) and gray matter (D) of wild-type rats, whereas there is no labeling with the

sense probe (B, E). No specific signal is detected in the mv rats with the antisense probe (C,

F). Bar: 50 μm

Fig. 8

Atrn in situ hybridization combined with immunohistochemistry for CNP (A-C) and GFAP

(D-F) in the lumbar spinal cord of wild-type rats. In the white matter, Atrn-positive cells are

mainly CNP-positive oligodendrocytes (A-C, arrowheads). In the gray matter, astrocytes are

occasionally positive for Atrn (D-F, arrowheads). Green; immunohistochemistry (FITC),

Plate II

Fig. 7

gray matter

white matter

antisense

sense

antisense

wild type

mv

F

C

E

D

B

A

Fig. 8

white matter

gray matter

CNP

/

Atrn

/

DAPI

GFAP

/

Atrn

/

DAPI

Atrn

CNP

Atrn

GFAP

F

C

E

D

B

A

Chapter 2

Microglial activation and gray matter lesions

in the mv rat

Section 2-1. Analysis of expression patterns of microglia-related factors

in the mv rat

Introduction

It was demonstrated in section 1-1 that microglial activation is confined to the gray

matter whereas morphological abnormalities of myelin sheaths were more apparent in the

white matter of the mv rat. These results raise the possibility that the microglial activation is

more than a simple reaction to the myelin destruction in the mv rat.

Microglia/macrophages are involved in the pathology of multiple sclerosis (MS) and

experimental autoimmune encephalomyelitis (EAE) by the production of various kinds of

cytokines. Activated microglia and infiltrating macrophages in demyelinating lesions of MS

and EAE show a strong upregulation of TNF-α, IL-1β and IL-6 (Benveniste, 1997; Raivich

and Banati, 2004). These cytokines have been proved to have detrimental effects on CNS

demyelination, one of which is the production of reactive oxygen and nitrogen species (Jack

et al., 2005; Raivich and Banati, 2004). Inducible nitrogen oxide synthase (iNOS) is

upregulated in astrocytes and macrophages in MS patients (Jack et al., 2007), and its product

nitric oxide (NO) is thought to be toxic to myelin (Raivich and Banati, 2004; Smith and

Lassmann, 2002). Transforming growth factor-β1 (TGF-β1) plays an important role as an

immunosuppressive cytokine in MS and EAE (Prud'homme and Piccirillo, 2000) and is

upregulated in infiltrating macrophages, activated microglia and reactive astrocytes in MS (De

In this section, the expression of several cytokines which are known to be related with

microglial activation in human and animal myelin diseases, was investigated to understand

the role of activated microglia in the gray matter of the mv rat.

Materials and Methods

Reverse transcription PCR (RT-PCR) for microglia-related factors

Cervical spinal cords of wild-type and mv rats at 4 and 6 weeks of age were removed

and dissected into the white and gray matter. Total RNA was isolated using SV Total RNA

isolation system (Promega) according to the manufacturer’s instructions. One μg of total

RNA was transcribed with Superscript II reverse transcriptase using random hexamers

(Invitrogen). To examine gene expression of TNF-α, IL-1β, and IL-6, first-strand cDNA was

amplified by a thermal cycler (PC 707; Astec, Japan) with GoTaq DNA polymerase

(Promega). To determine relative expression levels of iNOS and TGF-β1 genes, quantitative

real-time PCR was performed with a SYBR Green PCR master mix (Toyobo, Japan) in a

Linegene system (Bioflux, Japan). Details of specific primers are listed in Table 1. β-Actin

was used as an internal control. The cycling condition for real-time PCR was as follows: 1

cycle of 95°C for 1 min, followed by 45 cycles of 95°C for 15 sec, 60°C for 15 sec, and 72°C

for 30 sec. Relative expression levels were calculated based on threshold cycle (Ct) value

(comparative Ct method).

Western blot for iNOS protein

homogenized in a cell lysis reagent (CelLytic MT; Sigma). After centrifugation at 13,000 g for

10 min, protein concentrations were determined by the Bradford Protein Assay (BioRad,

USA). Ten μg of total proteins were separated on 7.5% polyacrylamide gels and transfered to

polyvinylidene difluoride membranes (BioRad). Membranes were incubated with mouse

anti-iNOS antibody as described elsewhere (Nakamura et al., 2006) and mouse anti-β-actin

antibody (Sigma) at 4°C overnight, and were treated with Histofine simplestain MAX PO for

30 min. Signals were visualized with ECL reagent (GE Healthcare, USA) and quantified with

a luminescent image analyzer (LAS-3000; Fujifilm, Japan). β-Actin was used as an internal

control.

Immunohistochemistry for iNOS

Lumbar spinal cords of control and mv rats at 6 weeks were sampled as previously

described (see Section 1-1, Materials and Methods). Ten-μm frozen sections were cut using a

cryostat. Sections were incubated with 10% normal goat serum in PBS for 30 min, treated

with mouse ant-iNOS antibody (Nakamura et al., 2006) at 4°C overnight, and incubated with

Histofine simplestain MAX PO for 45 min. Signals were visualized with DAB.

Statistical analysis

Data are presented as means ± standard deviation. Statistical analysis was performed

using one-way analysis of variance followed by Tukey’s test. A value of P less than 0.05 was

Results

Microglial activation is associated with increases in TGF-β1 and iNOS expression

To gain further insights into the role of activated microglia in the mv rat, the

expression of several factors associated with microglial activation was examined. Expression

levels of TGF-β1 mRNA were significantly increased in the gray matter of the mv rats

compared with wild-type rats at 6 weeks (Fig. 9A). Expression levels of iNOS mRNA were

not significantly changed between wild-type and mv rats at either age (Fig. 9B). There were

no obvious changes in the expression of TNF-α, IL-1β, and IL-6 mRNA between wild-type

and mv rats (data not shown). Western blot analysis demonstrated a significant increase in the

expression of iNOS protein in the spinal cord of the mv rats at 10 weeks (Fig. 10A).

Immunoreactivity for iNOS was weakly detected in astrocytes in the white matter of control

rats at 6 weeks (Fig. 10B, D), whereas it was markedly increased in activated astrocytes of

both the white and gray matter of mv rats (Fig. 10C, E).

Discussion

The results of this study demonstrated increased expression of TGF-β1 mRNA in the

spinal cord gray matter of the mv rat, which is coincident with the microglial activation.

TGF-β1 is normally present at low levels in the normal CNS tissues, while it is highly upregulated

in various cell types, such as activated microglia and astrocytes, and neurons in many

neurodegenerative diseases (Finch et al., 1993; Kiefer et al., 1998; Vivien and Ali, 2006; Zhu

et al., 2000). An in vivo analysis of TGF-β1-deficient mice revealed that lack of TGF-β1

microglial activation (Brionne et al., 2003). This finding is further supported by in vitro

studies demonstrating that TGF-β1 regulates microglial activity by inhibiting iNOS

expression (Lieb et al., 2003; Vincent et al., 1997) and NO production (Herrena-Molina and

von Bernhardi, 2005; Lieb et al., 2003). These data suggest that TGF-β1 may play a key role

in microglial activation in the mv rat.

ATRN is expressed on the cell surface of peripheral blood monocytes and involved in

their function in cell adhesion and release of cytokines including TGF-β1 (Wrenger et al.,

2006). Since microglia are believed to be derived from bone marrow during embryogenesis, it

is likely that ATRN may also be involved in microglial function, and that the lack of ATRN

may affect the function of microglia in the mv rat. Recent studies demonstrated abnormal

recruitment of macrophages/microglia during very early postnatal development and

subsequent activation of microglia in the brain of the zitter rat, suggesting that macrophage/

microglial lineage may contribute to myelin alterations in the zitter rat (Kadowaki et al.,

2007; Sakakibara et al., 2008). Further studies on the cytokine network should be needed to

understand the molecular mechanism and roles of microglial activation in the Atrn-mutant

animals.

The results of this study showed that expression of iNOS protein is significantly

increased in activated astrocytes both in the white and gray matter of the mv rat. However, the

author failed to detect a difference in iNOS mRNA levels between wild-type and mv rats. This

may be due to the sensitivity of the real-time PCR method, since the expression levels of

iNOS in the spinal cord of both groups were very low (more than 30 in Ct value). In the

demyelinating lesions of MS and EAE, iNOS is induced mainly in reactive astrocytes and

microglia/macrophages (Hill et al., 2004; Jack et al., 2007; Liu et al., 2001; Raivich and

Banati, 2004). iNOS produces a large amount of NO, and NO and its reactant with

and Benjamins, 2006; Smith et al., 1999) and mediators of damage to myelin (Bizzozero et

al., 2004; Boullerne and Benjamins, 2006; Jack et al., 2007; Smith et al., 1999). The results of

this study suggest that the activated astrocytes in the mv rat may be involved in the

Summary

The expression of microglia-related cytokines in the spinal cord of the mv rat was

investigated to explore the role of activated microglia in the gray matter. Increased expression

of TGF-β1 was closely associated with the microglial activation, which may indicate a key

role of this cytokine in the regulation of microglial activation in the mv rat. iNOS expression

was markedly increased in activated astrocytes both in the white and gray matter of the mv

rat, suggesting that the activated astrocytes in the mv rat may be involved in the progression

Table 1. Primers for RT-PCR analysis

Gene Primer sequence Accession number

TNF-α sense: 5’- TGTCTACTGAACTTCGGGGTG -3’ X66539

antisense: 5’-GAGGCTGACTTTCTCCTGGTA-3’

IL-1β sense: 5’-AAGCCTCGTGCTGTCGGACCC-3’ M15131

antisense: 5’-TCCAGCTGCAGGGTGGGTGTG-3’

IL-6 sense: 5’-ATGAAGTTTCTCTCCGCA-3’ M26744

antisense: 5’-GGGGTAGGAAGGACTATT-3’

iNOS sense: 5’-CCCTAAGAGTCACAAGCATCAAAAT-3’ D44591

antisense: 5’-GGTTCCTGTTGTTTCTATTTCCTTTGTTAC-3’

TGF-β1 sense: 5’-CTTCAGCTCCACAGAGAAGAACTGC-3’ X52498

antisense: 5’-CACGATCATGTTGGACAACTGCTCC-3’

β-Actin sense: 5’-TAAAGACCTCTATGCCAACAC-3’ BC063166

antisense: 5’-CTCCTGCTTGCTGATCCACAT-3’

TNF-α; tumor necrosis factor, IL-1β; interleukin-1β, IL-6; interleukin-6, iNOS; inducible nitric oxide synthase, TGF-β1; transforming growth factor-β1

Figure Legends

Fig. 9

Expression levels of TGF-β1 (A) and iNOS (B) mRNA in the cervical spinal cord of

wild-type (WT; white column) and mv rats (black column) at 4 and 6 weeks. Data are presented as

the mean ratio of target to reference gene (n=3 in each group). β-Actin is used as an internal

control. Expression levels of TGF-β1 mRNA are significantly increased in the gray matter of

mv rats at 6 weeks compared with control rats (A). Expression levels of iNOS mRNA do not

differ significantly between wild-type and mv rats at either age (B). *_{P<0.05 by Tukey's test.}

Fig. 10

Expression levels of iNOS protein in the thoracic spinal cord of wild-type (WT; white

column) and mv rats (black column) at 10 weeks (A). Data are presented as the mean ratio of

iNOS to β-actin levels (n=3 in each group). β-Actin is used as an internal control. Expression

levels of iNOS protein are significantly increased in the mv rats (A). Immunohistochemistry

for iNOS in the lumbar spinal cord of control (B, D) and mv rats (C, E). Compared with

control rats (B, D), iNOS immunoreactivity is markedly increased in activated astrocytes of

Plate III

Fig. 9

*

TGF-β1

iNOS

B

A

Fig. 10

*

A

B

E

D

C

Section 2-2. Analysis of expression patterns of myelin proteins in the mv rat

Introduction

Myelin proteins are specific components of myelin and oligodendrocytes and are

involved in formation and maintenance of myelin. Proteolipid protein (PLP) and its splice

variant DM20 are the most abundant proteins in CNS myelin, which constitute nearly 50% of

myelin proteins in the CNS but less than 0.5% in the PNS (Baumann and Pham-Dinh, 2001;

Garbay et al., 2000). In the CNS, PLP is localized in compact myelin (Schwob et al., 1985)

and subserves a structural function in maintaining the compaction of the myelin sheath (Greer

and Lees, 2002 ; Klugmann et al., 1997). The second most abundant protein in the CNS is

myelin basic protein (MBP), which comprises 30% and 5-15% of total myelin proteins in the

CNS and PNS, respectively (Boggs, 2006; Garbay et al., 2000). MBP is localized in major

dense line of both CNS and PNS myelin (Omlin et al., 1982) and is essential for myelin

compaction in the CNS (Boggs., 2006; Kwiecien et al., 1998). 2', 3'-Cyclic

nucleotide-3'-phosphodiesterase (CNP) represents 4% of CNS myelin proteins and less than 0.5% of PNS

myelin proteins (Braun et al., 2004; Garbay et al., 2000). CNP is expressed by

oligodendrocyte lineage from an early stage of CNS myelination, and is localized in

non-compact myelin (Braun et al., 1988; Trapp et al., 1988). Myelin oligodendrocyte glycoprotein

(MOG) is a quantitatively minor component of myelin, which is specific for the CNS and is

selectively localized at the outermost surface of the myelin sheath (Brunner et al., 1989; Johns

and Bernard, 1999). This protein is well known as an important candidate autoantigen in MS

and to induce EAE (Iglesias et al., 2001).

Recent immunohistochemical studies for myelin proteins have revealed extensive gray

Stadelmann et al., 2008). Gray matter lesions in MS patients are characterized by less

extensive inflammation, less gliosis, and more efficient myelin repair than the white matter,

leading to the proposal that pathogenesis is different between the white and gray matter. In the

mv rat, marked microglial activation is found exclusively in the gray matter of the spinal cord

from 6 weeks, whereas morphological anbormalities of myelin sheaths are more apparent in

the white matter (see section 1-1). Kondo et al. reported slightly delayed and weakened

immunoreactivity of some CNS myelin proteins during early myelination in the Atrn-mutant

zitter rat; however, there is no description of myelinogenesis in the gray matter (Kondo et al.,

1992).

To explore the role of Atrn in myelin protein production and to gain further insights

into the relationship bewteen gray matter lesions and microglial activation, the expression

patterns of major CNS myelin proteins in the mv rat was investigated.

Materials and Methods

Immunohistochemistry

Lumbar spinal cords of control and mv rats at 2, 4 and 6 weeks were sampled as

previously described (see Section 1-1, Materials and Methods). Tissues were routinely

processed and embedded in paraffin. Five-μm sections were dewaxed, pretreated in a

microwave with distilled water for 10 min, and incubated in 3% hydrogen peroxide for 10

min. Sections were then incubated overnight at 4°C with the following antibodies: mouse

anti-PLP (1:1,000; Millipore), mouse anti-MBP (1:1,000; Millipore), and mouse anti-MOG (a

kind gift from Dr. Morgan B.P.; University of Wales College of Medicine, UK) (Piddlesden et

anti-mouse IgG antibody (Histofine Simplestain MAX PO; Nichirei) for 45 min. Signals were

visualized with a DAB substrate kit (Vector Laboratories). Sections were lightly

counterstained with hematoxylin.

Western blot analysis

Cervical spinal cords of SD (wild-type) and mv rats at 6 weeks of age were dissected

into the white and gray matter, and homogenized in a cell lysis reagent (CelLytic MT; Sigma).

After centrifugation at 13,000 g for 10 min, the pellets were lysed in SDS sample buffer

(0.0625 Ｍ Tris-HCl, pH6.8, 2% SDS, 15% glycerol and 5% 2-mercaptoethanol) and then

boiled for 5 min. Samples were separated on 15% polyacrylamide gels and transferred to

polyvinylidene difluoride membranes (BioRad). Membranes were incubated with mouse

anti-PLP (1:2,500), mouse anti-MBP (1:10,000), mouse anti-MOG (1:1,000), mouse anti-CNP

(1:20,000; Millipore) and mouse anti-β-actin (1;10,000; Sigma) antibodies at 4°C overnight,

and were then treated with Histofine simplestain MAX PO for 30 min. Signals were

visualized with ECL or ECL plus reagents (GE Healthcare), and quantified with a luminescent

image analyzer (LAS-3000; Fujifilm). β-Actin was used as an internal control.

Real-time reverse transcriptase polymerase chain reaction (RT-PCR)

Cervical spinal cords of wild-type and mv rats at 4 and 6 weeks of age were dissected

into the white and gray matter. Total RNA was isolated with the SV Total RNA isolation

system (Promega) according to the manufacturer’s instructions. One μg of total RNA was

transcribed with Superscript II reverse transcriptase using random primers (Invitrogen).

a Linegene system (Bioflux). Details of specific primers are listed in Table 2. β-Actin was

used as an internal control. The relative expression levels were calculated using the

comparative Ct method.

In situ hybridization for PLP mRNA

For riboprobe preparation, a 568-bp fragment of the rat PLP cDNA (GenBank

accession no. NM_0309906539) was amplified by PCR (forward primer, 5’-TTT GGA GTG

GCA CTG TTC TG-3’, nucleotide position 201-220; reverse primer, 5’-GAA AAG CAT TCC

ATG GGA GA-3’, nucleotide position 749-768). The PCR product was subcloned into pGEM

T-easy vector (Promega). DIG-labeled sense or antisense riboprobe was synthesized with SP6

or T7 RNA polymerase (Roche), respectively. For in situ hybridization, lumbar spinal cords

were fixed in 4% PFA in 0.1 M PB at 4°C overnight, treated with 30% sucrose in PBS at 4°C

for 2 or 3 days, and frozen at -80°C. Ten-μm transverse sections were cut using a cryostat. In

situ hybridization was performed as previously described (see section 1-2, Materials and

Methods). RNA hybrids were immunostained with alkaline phosphatase-conjugated anti-DIG

antibody (1:1,000; Roche) at 4°C overnight and were visualized with BCIP/NBT substrate

(Roche).

Image analysis

Tissue sections were captured with a light microscope (BX41; Olympus, Japan) and a

digital camera (DS-Fi1; Nikon). Transverse lumbar spinal cord sections immunostained for

PLP, MBP and MOG were collected from three different animals in each experimental group.

gray matter was measured using a WinRoof software (Mitani Corporation). Data are

expressed as a percentage of positive area in each white or gray matter.

Cell counts

The number of PLP-positive oligodendrocytes in the white (dorsal funiculus) or gray

matter of the lumbar spinal cord was measured using a WinRoof software. Three different

transverse sections from three different animals were evaluated in each experimental group.

The data are presented as the number of PLP-positive cells/mm2_.

Statistical analysis

Data are presented as means ± standard deviation. Statistical analysis was performed

using one-way analysis of variance followed by Tukey’s test. A value of P less than 0.05 was

considered statistically significant.

Results

Expression of major CNS myelin proteins is decreased both in the white and gray matter

To clarify the distribution patterns of major CNS myelin proteins in the mv rat,

immunohistochemistry was performed using transverse spinal cord sections. In the white

matter of control rats, PLP immunoreactivity was observed from 2 weeks of age and gradually

increased with age (Fig. 11A-C). In control gray matter, PLP-positive myelin sheaths rapidly

distributed throughout the gray matter, showing a complex network of myelinated axons (Fig.

11D). Compared with control rats, PLP immunoreactivity was markedly decreased in the

white matter of mv rats from 2 weeks, and was more pronounced from 4 weeks (Fig. 11E-G).

PLP-positive myelin sheaths in the gray matter of mv rats were fewer than in control rats (Fig.

11E-G), which was most prominent at 6 weeks (Fig. 11H). PLP-positive vacuolated myelin

sheaths were diffusely observed in the gray matter of the mv rats (Fig. 11H, arrows).

Immunoreactivity for MBP in control rats gradually increased both in the white and gray

matter during postnatal myelination (Fig. 12A-D). Compared with control rats, reduced MBP

immunoreactivity was observed both in the white and gray matter of mv rats (Fig. 12E-H). As

observed in PLP immunohistochemistry, MBP-positve vacuolated myelin sheaths were

diffusely found in the gray matter of the mv rats (Fig. 12H, arrows). MOG immunoreactivity

in control white matter was weakly detected at 2 weeks and rapidly increased with age (Fig.

13A-C), while that in control gray matter was found from 4 weeks (Fig. 13A-C) and became

more intense at 6 weeks, showing a complex network of myelinated nerve fibers (Fig. 13D).

Compared with control rats, MOG immunoreactivity was markedly decreased in the white

matter of mv rats (Fig. 13E-G). MOG-positive myelin sheaths in the gray matter of mv rats

were fewer than in control rats (Fig. 13E-G); the difference was more apparent at 6 weeks

(Fig. 13H).

To evaluate the altered distribution of myelin proteins in the mv rat, the percentage of

positive area for myelin proteins was measured in the white or gray matter of control and mv

rats at 6 weeks, when the myelin lesions become most severe both in the white and gray

matter of the mv rat as previously described (see section 1-1). The results are shown in Table

3. In the white matter of the mv rats, there were significant decreases in the percentage of

positive area for PLP, MBP and MOG, of which the most severely affected was PLP

significant decreases in the percentage of positive area for PLP (16.9±0.9% in control vs.

5.1±0.5% in mv) and MOG (8.1±0.6% in control vs. 1.0±0.4% in mv), whereas only slight

decrease was observed in MBP immunostaining. These data correlated well with the

immunohistochemical findings described above.

To further investigate the changes in myelin proteins expression, Western blot analysis

was performed using samples from the white and gray matter of the cervical spinal cord at 6

weeks. Compared with wild-type rats, expression levels of PLP, MBP, CNP and MOG in mv

rats were slightly decreased in the white matter, and significantly decreased in the gray matter

(Fig. 14). These results strongly suggest gray matter hypomyelination in the spinal cord of the

mv rat.

Expression levels of PLP mRNA significantly decreases both in the white and gray matter

To analyze the expression patterns of myelin genes in the mv rat, real-time PCR for

four major CNS myelin genes was performed using samples from the white and gray matter

of the spinal cord at 4 and 6 weeks, when the gray matter lesions become more pronounced in

the mv rat as previously described (see section 1-1). Compared with wild-type rats, expression

levels of PLP mRNA significantly decreased in the white matter of mv rats at both 4 and 6

weeks (Fig. 15A). In the gray matter, expression levels of PLP mRNA were not substantially

changed between wild-type and mv rats at 4 weeks, and then significantly decreased in the mv

rats at 6 weeks. There were no significant changes in the expression of MBP, CNP and MOG

mRNA between wild-type and mv rats at either age, although overall there could be minor

The morphology and cell number of mature oligodendrocytes are not changed either in the white or gray matter

To determine whether Atrn mutation affects oligodendrogenesis in the gray matter of

the spinal cord, the morphology and cell number of oligodendrocytes in the mv rat were

examined by in situ hybridization with riboprobe for PLP mRNA, a marker for mature

oligodendrocytes. The PLP antisense probe labeled numerous oligodendrocytes in the white

and gray matter of control rats (Fig. 16A-D), whereas there was no labeling with the sense

probe (data not shown). No apparent difference was observed between control and mv rats in

the morphology of PLP-positive oligodendrocytes (Fig. 16). Furthermore, there was no

significant difference between control and mv rats in the number of PLP-positive

oligodendrocytes either in the white or gray matter (Fig. 17). These results confirm the

previous findings that Atrn mutation does not affect the cell number of CNP-positive

oligodendrocytes (see section 1-1).

Discussion

The results of this study demonstrated a marked reduction in the expression of myelin

proteins and PLP mRNA both in the white and gray matter of the mv rat during postnatal

development. Of the four major CNS myelin proteins examined, PLP was the most severely

affected in the mv rat. Since PLP is the most abundant and highly specific to the CNS

(Baumann et al., 2001; Garbay et al,. 2000), the decreased PLP expression in the mv rat can

be closely associated with the myelin alterations that are confined to the CNS (Kuwamura et

al., 2002). PLP is a highly hydrophobic tetraspan protein, localized in compact myelin.

normally and manage to assemble large amount of myelin (Hudson, 2004 ; Klugmann et al.,

1997). However, there are subtle but widespread ultrastructural abnormalities in the CNS

myelin; an increased numer of unmyelinated and thinly myelinated axons, disturbance of the

radial component of myelin ("diagonal" component), and most strikingly, irregular

interlamellar spaces of variable width (Rosenbluth et al., 2006; Yool et al., 2002). These

findings of "looser" myelin sheaths in the PLP-null mouse indicate a structural role of PLP in

maintaining myelin compaction along the external surface of the myelin lamella. In the mv

rat, myelin vacuolation is due to splitting of the myelin sheath and its frequency increases

with age, suggesting impaired maintenance of CNS myelin (Kuwamura et al., 2002 and this

study). It is possible that the severe reduction of PLP impairs the maintenance of myelin

compaction, resulting in myelin vacuolation in the mv rat.

MOG is regarded as an marker of developmental maturation of oligodendrocytes,

since it is not expressed by immature oligodendrocytes but by mature myelinating

oligodendrocytes (Trapp et al., 2004). Despite its importance as a target for autoimmune

attack in demyelinating diseases, the physiological function of MOG is still obscure.

Interestingly, MOG-deficient mice exhibit no morphological abnormalities in the CNS myelin

and axons, suggesting that MOG itself is not essential for normal CNS myelination (Delarasse

et al., 2003). Therefore the decrease of MOG in the mv rat seems to reflect an impairment of

oligodendrocyte maturation or of the production of MOG, rather than to cause structural

alterations in myelin sheaths. A recent histological study in the brain of the zitter rat revealed

severe morphological abnormalities of oligodendrocytes during postnatal myelination,

indicating an impairment of oligodendrocyte differentiation (Sakakibara et al., 2008). The

results of this study show that the composition and distribution of major myelin proteins are

oligodendrocytes are not affected. These data suggest an impairment of oligodendrocyte

differentiation and/or a failure of oligodendrocytes to produce myelin proteins in the mv rat.

The results of this study revealed severe hypomyelination in the gray matter of the mv

rat as well as the white matter. Recent studies in human MS have focused on the pathogenesis

of gray matter demyelination since it is thought to be more related with clinical disability than

that in the white matter (Pirko et al., 2007; Stadelmann et al., 2008). Gray matter lesions in

MS are characterized by a relative lack of lymphocyte infiltration, astrogliosis and microglial

activation, and more extensive remyelination compared with the white matter lesions (Albert

et al., 2007; Bo et al., 2003; Peterson et al., 2001). In murine cuprizone model of

demyelination, the time corse and dynamics of demyelination, and cellular responses differ

between the corpus callosum and cerebral cortex, of which the most striking is a considerable

reduction in the number of activated microglia in the cortex (Gudi et al., 2009).

Hypomyelination of the cerebral cortex is noted in the jimpy mutant mouse, a mutant with

myelin deficiency and oligodendrocyte cell death caused by a PLP mutation (Baracskay et al.,

2002). Oligodendrocyte number in the jimpy mouse is reduced in the cerebral cortex, but

increased in the white matter, supporting the hypothesis that oligodendrogenesis is

differentially regulated in the white and gray matter. Together, the results of this study suggest

that the microglial activation in the gray matter of the mv rat is closely associated with the

severe gray matter lesions, and that glial responses to myelin alterations could differ between

the white and gray matter. It remains to be elucidated whether this impairment is caused by an

intrinsic defect of Atrn-deficient oligodendrocytes or by a loss of interaction between

Summary

The expression patterns of major CNS myelin proteins in the spinal cord of the mv rat

were examined to explore the role of Atrn in myelin production and to examine the

relationship between the gray matter lesions and microglial activation in the mv rat.

Immunohistochemical and Western blot analyses demonstrated a considerable reduction in the

expression of major CNS myelin proteins both in the white and gray matter of the mv rat.

Real-time PCR analysis revealed a significant decrease in the expression of PLP mRNA both

in the white and gray matter of the mv rat. However, there was no significant difference in the

cell number of PLP mRNA-positive oligodendrocytes between control and mv rats either in

the white or gray matter, suggesting an impairment of oligodendrocytes in the myelin protein

production. The results of this study indicate that myelinogenesis but not oligodendrogenesis

is severely altered both in the white and gray matter of the mv rat, and that microglial

activation is closely associated with the severe hypomyelination in the gray matter of the mv

Table 2. Primers for real-time RT-PCR

Gene Primer sequence Primer location Accession number Note

PLP forward: 5’- TTGTTTGGGAAAATGGCTAGGA -3’ at the end of exon3 NM_0309906539 specific to PLP,

reverse: 5’-GCAGATGGACAGAAGGTTGGA-3’ exon5 excluding its splice variant DM20

MBP forward: 5’- TCACAGAAGAGACCCTCACAGC -3’ exon1 NM_001025291 common for all 6 splice variants

reverse: 5’-GAGTCAAGGATGCCCGTGTC-3’ exon1 of MBP

CNP forward: 5’- TCCGAGGAGTACAAGCGTCT -3’ exon2 NM_012809

reverse: 5’-ACAGCTGCCATTGGTTCTTC-3’ exon2

MOG forward: 5’- TCCGTGCAGAAGTCGAGAA -3’ between exon 4 and 5 NM_022668

reverse: 5’-CCATCACTCAAAAGGGGTTTC-3’ exon8

β-Actin forward: 5’-TAAAGACCTCTATGCCAACAC-3’ exon5 NM_031144

reverse: 5’-CTCCTGCTTGCTGATCCACAT-3’ exon6

PLP; proteolipid protein, MBP; myelin basic protein, CNP; 2',3'-cyclic nucleotide 3'-phosphodiesterase, MOG; myelin oligodendrocyte glycoprotein

Table 3. Percentage of positive area for myelin proteins

white matter gray matter

control mv control mv

PLP 55.5±4 20.6±3 * _{16.9±0.9 5.1±0.5} *

MBP 45.8±4 29.8±2 * _{6.4±0.6 3.7±1}

MOG 36.2±2 24.3±1 * _{8.1±0.6 1.0±0.4} *

PLP; proteolipid protein, MBP; myelin basic protein, MOG; myelin oligodendrocyte glycoprotein