全文

(1)Acta Histochem.. Expression. and. Localization. Tomohiko. Wakayama. of Urinary. Trypsin. Cytochem.. Inhibitor. Vol. 30 Nos . 5 & 6, 557-565 (1997). in the Rat. Embryo. and Shoichi Iseki. Departmentof Anatomy,Schoolof Medicine , KanazawaUniversity, Kanazawa920-0934 Receivedfor publicationNovember6, 1997and in revisedformJanuary13, 1998. Urinary. trypsin. inhibitor. (UTI). protein with anti-proteolytic constitutes the active domain α‑. trypsin. inhibitor.. UTI. has. is an. acidic. activity of serum. that inter-. been. liver. demon-. strated not only in the adult urine but also in the amniotic fluid of late pregnancy . In order to examine the expression and localization of UTI in the rat embryo and placenta, we performed a combination of reverse transcription-polymerase chain reaction (RTPCR), in situ hybridization and immunohistochemistry. UTI mRNA expression was detected by RT-PCR in the embryo on and after the day 12 of gestation (E12) but not in the placenta throughout the prenatal. I.. words:. Urinary trypsin histochemistry,. E12 from. but. immunoreactivity. to. the. cells. and. localized. results the. of. proximal. the. cells,. was. and. localized. cells. that. in the. were. cells. and. rat embryo, is the. only. and. a part. role during. fetal of. UTI. of amniotic. intestine, in. the. protection. late. pregnancy.. inhibitor (UTI), RT-PCR, Development, Rat (Wistar). In. situ. in for. into fluid,. UTI is reabsorbed. suggesting. the. as site. of UTI, that UTI is excreted and thereby into the amniotic. that. ab-. These. production the urine in the. were. lysosomes. respectively.. hepatocyte. en-. immuno-. intestine. apical. the. the. the. epithelial cells,. and. and. whereas. to the. tubular. indicated. liver. hepatocytes. kidney. epithelial. adult,. kidney microscopy,. In contrast,. exclusively. sorptive. the. hematopoietic. reaction.. noreactivities of. of of. of Kupffer. of the. in. On electron. surface. dothelial free. also. E18.. the. lysozomes. period. In situ hybridization revealed that UTI transcripts were localized in the liver but not in any other organs of embryo from E12 through E20. On the other hand, UTI immunoreactivity was detected not only in the Key. from. intestine. hybridization,. a possible of. the. fetus. Immuno-. activity [20]. In regard to the expression and cellular localization of UTI, our previous study in the adult rat has revealed that, while the hepatocyte is the only site for expression of UTI mRNA, the immunoreactivity for UTI is present not only in the hepatocytes but also in the Kupffer cells of the liver and the proximal tubular epithelial cells of kidney, suggesting that UTI produced by the hepatocytes is partly reabsorbed in the liver and kidney and thereby regulates its concentrations in the blood and urine [35]. It remains to be examined, however, if the expression and cellular localization of UTI obtained in the adult is also applicable to the embryo. There is evidence that systems of proteases and their inhibitors play important roles in the embryonic organ differentiation [24, 27, 31]. Furthermore, UTI is present in the amniotic fluid of late pregnancy, suggesting its role in the maintenance of pregnancy [16]. In the present study, to elucidate the expression and localization of UTI in the embryo as well as the origin and fate of amniotic UTI, we have examined the. Introduction. Urinary trypsin inhibitor (UTI) , also referred to as urinastatin, HI-30, ASPI or bikunin, is an acidic glycoprotein with 143 amino acid residues present in the urine of both human and rodents [4, 8, 12, 30, 34]. In the serum, UTI represents the functional domain of inter-a-trypsin inhibitor (ITI). ITI is composed of 2 heavy chains and a light chain identical with UTI, which are coded by 3 different genes [1, 9, 10, 18, 23, 26]. UTI has two Kunitztype peptide domains that inhibit the activity of a variety of proteinases, including trypsin, chymotrypsin, plasmin, cathepsin G and neutrophil elastase [18, 21]. Although the physiological significance of UTI is still unclear, it has been used for many clinical purposes including the treatment of acute pancreatitis based on its anti-proteolytic Correspondence to: Dr. Tomohiko Wakayama, Department of Anatomy, School of Medicine, Kanazawa University, 13-1 Takaramachi, Kanazawa 920-0934, Japan. 557.

(2) 558. Wakayama. embryo. and. placenta. histochemical munoreactivity. II.. of. Animals. and. and. Adult. tissue. Wistar. morning. designated tas. at. were. the. pregnant. rats. E10, the. and. nitrogen. and. tion.. Only. including For. at -80•Ž. in. case. situ. the embryo. embryos. and. paraformaldehyde 4hr. at 4•Ž. 30%. sucrose. then. 0.1M. overnight. of. Kyoto,. primers. spanning. 1087. rat. cDNA. UTI. cycle. consisted. 72•Ž. for. the. for whole. was. liquid extrac-. 4•Ž. for. The. primers. sequences. for. RT-PCR,. tion. analyses. and. of. the. as specimen.. Southern. immersion (pH. buffer. in. 4%. 7.2). for. containing. were. as. follows.. 3'primer,. X-Omat. situ. 1079-1099);. 14ƒÊm. probe,. coated. fixed. probe,. glass. 7.2). ing. to. given. published. of. to. us. were. by. UTI. cDNA. Bioscience. Pharmaceutical. Co.,. 3-phosphate. Research. Ltd.,. 840-869);. dehydrogenase. accord-. [14]. and. Japan.. kindly. Mochida. Glyceraldehyde-. (G3PDH). 5'primer,. 5'AC-. CACAGTCCATGCCATCAC3'(nucleotides586-605) G3PDH. 3'primer,. (complement. of. Laboratories,. and. 5'TCCACCACCCTGTTGCTGTA3' 1018-1037). Palo. were. Alto,. from. Clontech. Ca.. in the. by. the. acid. method. [6],. guanidinium using. Friendswood,. Tex. in. transcription. (RT) leukemia. Osaka,. Japan).. duct. was. amplified. from. kit. (RNAzol). Aliquots amount, at virus. each. frozen. specimen. of. from each. were 42•Ž. reverse. Subsequently, in a DNA. for. Tel-Test,. total. RNA. subjected 90min. an thermal. aliquot cycler. Inc., sample,. to. reverse. using. transcriptase. mem-. Co.. of. the. Ltd.,. Bio-. Hamamatsu, was. exposed. to. each (MJ. at. an. times. each. of. incubation. labeled. for. sarcosinate. for. graded. The. were up. a total. to. 37•Ž,. of. air-dried for. dipped 3 weeks. Kodak. ylin. and. eosin,. were. with. N-lauroyl. dehydrated. 0.3M first. (200. washed. sodium and. other. After. with. ammonium. exposed. to. emulsion. BIOand. and. exposed. microautoradiography. D19,. examined. bright-. the probe. macroautoradiography,. in Kodak and. slides. ex-. labeled. mixture.. 0.1%. NTB-2. for. the and. probe. were. pro-. control. replace. probe,. at 37•Ž. for. 35S-labeled. negative. containing slides. at 4•Ž. developed. under. 3 hr. 10 days in. then. the with. ethanol. antisense. the. After. graded. pre-hybridization. to. sense. to. series. were. microscope. at. of. unlabeled. 0.3•~SSC. ethanol. (Kodak). of. of. was. DNA. a. the. 100ƒÊl. labeled. probe). 16hr of. sperm. kinds. was 0.1M. solution,2%. with. to. room. 2-mercaptoethanol,. with. One. the. at. 4•~SSC,. 20mM. Two. 2mg/ml. solution. 1•~Denhardt's. hybridized. fixed buffer. pre-hybridized. salmon. amount. were. anhydride/0.1M. formamide,. dpm. into. gelatin-. containing. acetic. dehydration. slide.. with. PBS. and. performed.. changes. then. they. pre-hybridization. 7.2),. were. excess. that. with. deionized. 1.0•~106. cut. on. air-dried,. 0.25%. The. and. were. mounted. phosphate. 8.0),. (pH. probe. add. being. sarcosinate,. were. antisense. embryos. with. and. dark. They. stained. with. an field. hematox-. Olympus. BH-2. conditions.. Moloney. (Toyobo of. (BRL, the. a BAS2000. membrane. and. denatured. for. periments. for. thiocyanate-phenol-chloroform. a. 0.5ƒÊg-20ƒÊg. murine. extracted. 50%. sections. added. MAX was. (pH 2hr.. 2•~SSC. acetate.. RNA. at DE). autoradiography.. washed. buffer. solution. a. RT-PCR Total. After. N-lauroyl. three. purchased. labeled. with. with. Film. cryostat. with. for of. series,. to. a. 15min,. 250mg/ml. bes. Laboratory,. Tokyo,. antisense. was. radioactivities. cryoprotected. slides.. for. sodium. rinse. synthesized. sequence. relative. for. nylon. Wilmington,. paraformaldehyde/0.1M. temperature. and. 5'AAGGAATGCCTGCAG-ACG. rat. and. acetylated. phosphate. UTI. 5'TATGGTCCGGCA-. TGCCGGACCATA3'(840-869). 30-base. Pont,. of was. according. transferase. the film. on. 4%. 5'TGCA-. 5'primer,. CGTCTGCAGGCATTCCTT3'(complement sense-UTI. AR. sections. composed. 12-32);. UTI. A. hybridized. Photo. onto. NY). mRNA. cyles. hybridization. The. hybridiza-. 5'GCTACCCTCTGGCTTGCAGAC3'(compleof. and. used. situ. GAGCCATGCAGGGTCTC3'(nucleotides. ment. blotted. UTI. and using. mixture. Hills,. measured. subsequently. triethanolamine. UTI. were. (Fuji. Kodak. (pH. oligonucleotides in. 10-30. [29].. was the. bands. analyzer. with. probes. and. and. washing,. and. In. cryoprotection.. blotting. After. gel,. (Du. 1min. reaction. deoxyribonucleotidyl MD). Japan). the. buffer. synthetic. rat. [ƒ¿-32P]dCTP. After. glycine, Oligonucleotide. for. for. the. RT-PCR. East. of. amplification. 60•Ž. each. 21-base region. conceptive. used. by. with. Each. sec,. agarose. procedure. of. coding. control,. of. polymerase. pair. the. performed.. 1%. probe. of. 30. aliquot a. blot. terminal. Image. for. also. DNA a. 100ƒÊl.. BioSupport,. Gaithersburg,. hybridization. immunohistochemistry, fixed. Southern. reverse the. RNA. was. on. 3' end. length. positive. a 20ƒÊl. Taq and. of. 94•Ž. (Pall. using. by. For. primers. brane.. in. of. 2min.. oligonucleotide the. using Japan). in a mixture. amplification,. sodium. (RT-PCR),. use. E10,. and the. For. in phosphate. at. E 18. separately. phosphate. rinsed. placen-. E16,. weight).. placenta. were. in and. and. Mass.),. Shuzo,. to. was. anesthetizing. reaction. and. placentas. Watertown,. membrane. examined. positivity. E14,. frozen. of. and. were. after. until. hybridization. Inc., (Takara. electrophoresed. standard. injection. were. stored. both. in. E12,. chain placentas. (Hamama-. Fetuses. uteri. body. transcription-polymerase. Inc.. sperm. intraperitoneal. (50mg/kg. embryos. im-. estrous. under. 0 (E0).. i.e., from. with. pentobarbital. of and. normal. smears of. day. stages,. removed. with. males. day. embryonic. different. E20,. combination mRNA. SLC,. with Vaginal. and. as. rats. Japan. mated. conditions.. every. a. the. G3PDH strain. from. and. laboratory. with. Methods. purchased. Japan). rat detect. preparation. female. were. tsu,. the that. UTI.. Materials. cycles. of. methods. and Iseki. Inc., RT. pro-. Research,. Immunohistochemistry A (MiraclidR). polyclonal was. antiserum raised. against. in a rabbit,. purified and. its. IgG. human. UTI. fraction. was.

(3) Urinary. Trypsin. Inhibitor. purified and kindly provided to us by Mochida Pharmaceutical Co., Ltd., Tokyo, Japan. On a Western blot analysis, this antibody was confirmed to react specifically with human UTI and also form a single immunoreactive band with the urine, liver homogenate and kidney homogenate from adult rats [35]. For light microscopic immunohistochemistry, the cryostat sections were treated successively with 0.3% Triton-X100 in PBS for 1hr for cell permeabilization, 0.3% H2O2in methanol for 10min for inhibition of intrinsic peroxidase activity and 5% normal porcine serum for 30min for prevention of non-. in Rat Embryo. specific. 1. and. The. signal. cycle. analysis. primers.. intensities The. against. RT-PCR. G3PDH. tivities.. binding.. overnight. antibody. at the. control,. the (100ƒÊg/ml,. Co.,. Ltd.). for. 4hr in. visualized. by. biotinylated. absorbed. gift. at 4•Ž. of. to. sites. incubating. peroxidase-conjugated. use.. of. the IgG. by. negative human. Pharmaceutical After. sections. antibody. solution. For. the. sections. immunoreaction. were. successively for. streptavidin. diaminobenzidine. were. anti-UTI. purified. Mochida. prior. the. anti-rabbit. sections with. of 0.54ƒÊg/ml.. kind. PBS,. the. temperature. was. a. washed. room. concentration. antibody. UTI. were. Subsequently,. at. 1hr,. for. containing. with. horseradish. 1hr. and. H2O2. for. 3,3'a. few. B. Quantitative. UTI. antibody. incubated. A. Fig.. 559. The. of. values. hybridization. for. numbers. of UTI. amplified. UTI (B;. bands. product. the. mRNA.. (•œ). template. The. products were and. RNA. from. electrophoresed,. measured. G3PDH. amount. total. were. with. product. image (•¢). E12embryo blotted. analyzer. were. was. and and. plotted. used. as template. hybridized. with. expressed. against. as. template. and. subjected. 32P-labeled. the. arbitrary. amounts. UTI. to RT-PCR and. logarithm (A;. the. G3PDH values. cycle. using probes.. of. number. radioacis 20). and. is 2ƒÊg).. UTI. G3PDH. Fig.. 2.. Autoradiograms. specimens. from. E20. (lane. 6) were. and. 20. amplification. probes.. in. The. showing. the. sizes. whole. subjected. to cycle. of. RT-PCR. conceptive. amplified. RT-PCR. number. DNA. analysis. of EIO. (lane. using. UTI. The. amplified. (bp). are. of 1),. the. the. primers. indicated.. expression. embryos. products. and. of of E12. G3PDH were. UTI (lane. primers.. electrophoresed,. mRNA 2),. in. the. E16. (lane. The. conditions. blotted. 3),. and. rat the. embryos placentas for. and of. RT-PCR. hybridized. with. placentas. E12. (lane. 4),. were. 2ƒÊg. in. 32P-labeled. The. total. RNA. E16. (lane. 5) and. template. amount. UTI. G3PDH. and.

(4) 560. Wakayama. minutes,. using. a. LSAB2. kit. (Dakopatts,. and. Glostrup,. Denmark). For. electron-microscopic. immuno-gold ed. method. with. 4%. ethanol. and. London,. in. U.K.). containing 1%. polymerized. for. polymerizer.. microtome,. mounted. of. at. 4•Ž. with. 0.54ƒÊg/ml.. visualized. 3,. absense localized Fig.. 5.. on. at. the. IgG. Macro-autoradiograms (3A, to. 4A) the. and liver. (3B,. (arrows).. 3B,. Micro-autoradiogram. mRNA. signal. chymal. cells. is located with. small. 4B) 4B:. showing mostly or. round. in. in the. dark. (British. in of. situ. excess. III.. Results. an. Expression. a. No. signal. hybridization. hepatocytes. and then. washed were. subjected. to. in. PBS. briefly. and. stained. observation. then. in. with. with. 2%. a Hitachi. microscope.. as. of. E12. of unlabeled. large. arrows).•~300.. in the pale. any. liver. B) probe.. The. of of. E16 3A,. in. RNA by. B). The. of. both RNA up. embryos signal. of. cDNA. E12. to. products. embryo. hybridization. template. (4A,. embryo. from. amplification. 4A:. the. titration. intensities. amount. and. the. primers. number. (3A, UTI. mRNA. total. G3PDH. the. the. BioCell,. UTI. shows. of. probes.. 20nm. of. 1. RT-PCR. is recognized. with (small. being. sections. and. of. Fig.. over-. hybridization amount. situ. nuclei. electron. with. colloidal. antibody. showing. presence. cut. were. with. acetate. H-700. concentration. immunoreaction sections. uranyl. After the. graded. incubated. at the. water,. the. with. were. and. U.K.).. distilled. fix-. peroxide,. temperature sections. Cardiff,. (London. benzoil. grids. of. in. Resin. antibody. sites. anti-rabbit. 4.. dehydrated. room. nickel. anti-UTI. specimens. LR-White. Ultrathin. incubating. gold-conjugated. Figs.. 48hr. The by. The. were. embedded. ultraviolet. night. performed.. paraformaldehyde. series,. Resin,. immunocytochemistry, was. Iseki. with. signals. elevated up. with. 35S-labeled. representing. UTI. UTI. 32P-labeled. increased 25 cycles.. in. with. linearly to. 4ƒÊg. and. Accordingly,. UTI mRNA. probe. in. the. is exclusively. organs.•~5. from. nuclei. E16 (large. embryo arrows),. with. UTI. whereas. probe. they. The are. silver. scarcely. grains recognized. representing in. the. UTI mesen-.

(5) Urinary. RT-PCR. was. cycles. for. performed. all. UTI. cDNA. was. The. signal. at. embryo, a. tions,. the. of. in. intensity. for. through. E20,. all RNA. samples. as. placenta. of. E12,. of. mRNA. embryo,. in. E12,. an. any. other. an. continued. to. intensity. with was. detectable On. the. UTI. entire. liver. level,. the. the. indicated. not. hepatocyte. the. respectively,. in. amount. of. On. light. in. the. organs embryo. microscopic. ting. When. the. 8,. antibody. Fig.. 10. epithelial. 9.. (K).. No. cell Light The. Electron cell. the. results and. the. population, a. detectable. in the fetal. liver. no. stain-. No. from. The liver. with. of. E16. (B).. E16. of. UTI. embryo. A:. treated. The in. embryo. abundantly. numbers. liver. any. the. particles. for. surface. are. immunohistochemistry. is diffusely. with. immunostaied,. anti-UTI. whereas. the. antibody kidney. (K). (A) and. and. anti-UTI. intestine. (I). are. organs.•~40.. treated. on. for. (L). immunocytochemistry of. present. hepatocyte on. the. with (Hp). and. surfaces. of. anti-UTI. are. also. Kupffer. antibody.. accumulated cell,. Gold in. sinusoidal. the. particles. represen-. lysosome. endothelial. (arrow) cell. (E). of and. Bar=1ƒÊm. of. the. immunoreactivity. kidney. is localized of. Gold. 6A). entire. is recognized. liver. (Hm).•~21,000;. was. the. UTI. deposited. appreciable. In. liver. (Fig.. part. human. Immunohistochemical localization of UTI in the fetal intestine In the embryos from E18 through E20, portions of the intestine were stained moderately with anti-UTI antibody (Figs. 11, 12). The immunoreactivity was stronger in more proximal portions of the duodenum-rectum axis and in upper portions of the crypt-villus axis, located primarily in the apical cytoplasm of absorptive epithelial cells. Preabsorption of anti-UTI antibody with purified. embryo. period.. preabsorbed. abdominal. of the are. E10. the. on. immunostaining. micrograph. in. E20,. was. the. micrographs. is shown.. UTI. intensity. purified. micrographs. hematopoietic Figs.. of with. B:. cell. These. entire. diffusely. antibody. immunoreactivity. Kupffer. in. liver. examined. through. moderate. micrographs. Electron UTI. 5).. recognized the. E12. preabsorbed. 7.. was. distributed. immunonegative. Fig.. the. cellular. populations. express. of. throughout. with. Light. the. immunohistochemistry,. from. immunoreactivity. 6.. At. the. the. that. antibody. placenta. antibody. grains over. primarily. (Fig.. and. signal. silver. cell. E12,. localization. immunostained. Fig.. no. examined. distributed. localized. cells. increasing. the. mesenchymal. in. signal. mRNA.. embryos. lobule.. with. E20.. from. only. anti-UTI. the. be. At not. The. contrast,. were. E10. but. B).. liver In. through. the. signal of. liver. the. to. in. rat. UTI. Immunohistochemical localization of UTI in the fetal kidney Before E18, no UTI immunoreactivity was recognized in the organs other than the liver. In the embryos from E18 through E20, however, portions of the kidney were stained intensely with anti-UTI antibody (Figs. 8, 9). The immunoreactivity was localized primarily in the proximal convoluted tubuli of renal cortex, where the apical cytoplasm of epithelial cells showed a granular appearance with immunostaining. The other portions of cortex as well as the medulla showed no apparent immunostaining. Preabsorption of anti-UTI antibody with purified UTI abolished the reaction, confirming the specificity of immunoreaction (not shown). On electron microscopic immunocytochemistry of proximal tubular epithelial cells (Fig. 10), abundant gold particles were accumulated exclusively in the large vacuoles occupying the apical cytoplasm, which were identified as lysosomes according to previous literatures [25]. The immunoreactivity was also found in the basal lamina of glomerulus., whereas other portions of kidney, including the distal tubulus and collecting duct, were free of the reaction.. the. RT-PCR.. throughout. E12. Immunohistochemical. with. of. 3A,. the. signal. beginning. are. in. portions. 561. a. embryo. occurs. in the. B).. hematopoietic. that,. rat. liver. result. (Fig. to. appeared. and. of that. hybridization any. the. placenta. from. grains. including. fetal. in. 4A,. mRNA. lobule. hepatocytes. in the. microautoradiography,. representing. E10. indicated. mRNA. the. embryo. (Fig.. in. with. activities. results. UTI. condi-. from. template. recognized. localized. E20. same. detected. placentas. occurs. in. agreement. be. until. period.. or. and. contrast, placentas. the. was. no. of. In the. pregnancy.. deteced. portions. it reached. Under. no. mRNA. signal. where. intact. was. intense. E12. E18,. cDNA. whereas. UTI. E10.. in. in. mRNA. the. of. appeared. E20.. These. UTI. conceptive. in Rat Embryo. oligopeptide, the liver staining was abolished completely, confirming the specificity of the immunoreaction (Fig. 6B). On electron microscopic immunocytochemistry, gold particles representing UTI-immunoreactivity were distributed primarily on the surface of hepatocytes facing the sinusoidal capillary (Fig. 7), whereas they were scarcely found in the cytoplasm of hepatocytes. The immunoreactivity was also present with high intensity in the lysosomes of Kupffer cells. No apparent reactivity was recognized on the surface of Kupffer cells or in any portions of sinusoidal endothelial cells and hematopoietic cells.. 20. amplified. first. until. embryos. Inhibitor. for. for. detected. macroautoradiography,. UTI. ing. until. examined.. at. by. the. throughout. On. was. all. templates. signal. period.. confirming. Localization. whole. G3PDH. in. amount. early. the. was. observation. of. No. maintained. the. intensities. 2ƒÊg. 2).. 1100. signal. signal. similar. detectable. in. size. was. cDNA. throughout. for. detected the. and. UTI. as. (Fig.. increased. plateau. no. with. samples. Trypsin. the particles. kidney. from in from. are. E18. (Fig.. part. (Fig.. E20. embryo. accumulated. 8) and 8) and. E20. most. treated. densely. for inthe. (Fig. (Fig.. 9) embryos 9) of the. regions. immunocytochemistry lysosomes. of. apical. treated. for. of. immunohistochemistry. proximal. with cytoplasm. tubules.. anti-UTI. antibody.. (arrows).•~11,000;. Fig.. with 8•~40;. Fig.. A proximal Bar=1ƒÊm.. anti-UTI 9•~100. tubular.

(6) 562. Wakayama. Figs.. and Iseki. 6-10.

(7) Urinary. Figs.. 11,. 12.. Light. micrographs. immunohistochemistry of Fig.. villi. 13.. Fig.. with 11•~40;. Electron. absorptive. epithelial. Fig.. micrograph cell. of anti-UTI. the antibody. proximal .. Trypsin. part The. of. Inhibitor. intestine. in Rat Embryo. from. immunoreactivity. is localized. E18. (Fig in part. 563. .. 11). (Fig.. and. E20. 11) and. most. (Fig.. 12). (Fig.. 12). embryos of the. treated. epithelial. for regions. 12•~100. of is shown.. the. proximal Gold. part particles. of are. intestine. from. accumulated. E20treated in. the. for. electron-dense. immunocytochemistry vesicles. of. with apical. cytoplasm. anti-UTI (arrows). antibody. .. An. .•~21,000;. Bar=1ƒÊm.. UTI abolished the reaction, confirming the specificity of immunoreaction (not shown). On electron microscopic immunocytochemistry, the apical cytoplasmic vacuoles of absorptive epithelial cells, although smaller in number and size as compared with those of proximal tubular epithelial cells, demonstrated accumulation of gold particles (Fig. 13). In contrast, the goblet cells had no immunoreactivity in any portions. IV.. Discussion. The present study has confirmed in the prenatal rat, on the basis of localization of both mRNA and immunoreactivity for UTI, that the hepatocyte is the only origin of UTI, as it was previously established in the adult rat [35]. The liver is known to develop from around E11 out of the foregut epithelium [16] and to produce liverspecific marker proteins such as a-fetoprotein, albumin, transferrin, transthyretin and retinol-binding protein from E12 [1, 7, 32]. The present results have revealed that UTI. is produced from very early stages of liver development, suggesting an important role of UTI in the latter embryonic periods. The immuno-electron microscopy of embryonic liver demonstrates that UTI reactivity is located primarily on the surface rather than in the cytoplasm of hepatocytes, an observation similar to that in the adult liver [35]. Since UTI (or its combined form, ITI) is known to have hyaluronan-binding activity [5, 11], this result suggests that UTI produced in the hepatocytes is promptly secreted into the space of Disse, where a part of it is adsorbed by the hepatocyte surface. Furthermore, it is demonstrated that Kupffer cells have UTI immunoreactivity in their lysosomes, as previously shown in the adult liver, suggesting that a part of secreted UTI is incorporated into Kupffer cells by endocytosis. The absorption by the hepatocyte surface and incorporation by Kupffer cells of UTI may represent local mechanisms that regulate the amount of UTI entering the blood stream. In the adult human the majority of plasma UTI component is known.

(8) 564. Wakayama. to exist as ITI [10], and there is in vitro evidence that UTI binds the heavy chains to form ITI before it is secreted from the hepatocytes [2, 19]. However, if it is also the case in the rat embryo, it is unknown in the present study. The biological significance of UTI (or ITI) in the adult human and animals is considered to be primarily the organic protection based on its antiproteolytic activity [17, 20]. In the case of embryo, there is evidence that proteases and their inhibitors play important roles in the development of tissues and organs, as shown in the activation of growth factors, epithelium-mesenchyme interaction and differentiation of nervous system [27]. However, the present study has revealed that UTI occurs concurrently coincident with the development of liver around E12, which is a relatively later stage of rat development. Therefore, it seems unlikely that UTI plays critical roles in the tissue and organ differentiation. Taking into account also that the pancreas-specific digestive enzymes appear from around E16-E18 [33], the primary role of UTI is likely the protection of fetal tissues and organs in the latter periods of development based on its antiproteolytic activity. In the embryonic kidney, from E18, the immuno-electron microscopy has demonstrated that an intense UTI reactivity is located in the lysosomes of proximal tubular epithelial cells, an observation similar to that in the adult kidney [35]. Taking into account that no UTI mRNA is expressed in the kidney, this result suggests that UTI passes through the glomerulus into the primary urine and a part of it is reabsorbed by the proximal tubular epithelial cells. Past studies also indicate that these cells incorporate various low-molecular-weight proteins from the primary urine into their lysosomes from around E18, consistent with the present observation. It is also possible that the excretion of UTI into the fetal urine itself begins earlier than E18, because the apparatus for glomerular filtration is known to develop from as early as E16 [25]. The rate of reabsorption of UTI by the proximal tubular epithelial cells, together with the glomerular filtration rate for UTI, may regulate the amount of UTI excretion into the fetal urine during the terminal periods of rat development. Past studies have established that the majority of the amount of amniotic fluid in the terminal periods of pregnancy is derived from the fetal urine [22]. In the humans, UTI is known to appear in the amniotic fluid during the later periods of pregnancy [16]. Although there has been no study that quantitates UTI concentration in the rat amniotic fluid, the present result suggests that at least a part of UTI in the rat amniotic fluid of terminal pregnancy is derived from the fetal urine. Since no detectable level of UTI mRNA is expressed in the placenta, the possibility of UTI production and secretion by the placenta seems to be excluded. However, the extent of possible contribution of maternal UTI to amniotic fluid UTI is unknown. The biological role of amniotic fluid UTI may be the protection of fetus and placenta on the basis of its. and Iseki. antiproteolytic. activity.. The. present. study. munoreactivity epithelial. cells. widely. of. swallows. amount. of. amniotic. weight. and. considered. the. to. be. fetus. uptake. of. newborn. is. preted,. 13].. UTI. is. fluid. UTI,. as. by. the. the. circulating.. operating. the. luminal. not. gastrointestinal an. lysosomal. for. in. the. suckling interamamniotic. of. amniotic. protection,. may. but. on of. of. be. that. surface. i.e.,. [13].. swallowed. function. possibly. role. of can. organ. outer. are. endocytotic. intestine. suggesting. and. by. that. intestine. the. of. also. nature. the. observation. fetus,. and. important. in. prerequisite. the. of. tract. play. or. in. on. are cells. vesicles. mechanism. tissue. only. surface. apical. biological. the. molecular. intestine. reabsorption. The. probably. be. the. intestine,. fetal fluids.. high. fetal. the. low. the. amniotic. in. present. fetal. Many by. epithelial. in. The. therefore, UTI. this. together circulation. 28].. certain. of. components. 3,. a. absorptive. probably. milk [1,. lumen. endosomal of. which,. swallowed that. accumulated. development. terminal. the. the. fluid, constitute 22,. It is. pregnancy. incorporated. evidence. in into. endocytosis. may. is. substances. incorporated. niotic. from. there. E18.. terminal. [13,. be. im-. absorptive. from. of. fluid. tract. Furthermore,. of. intestine. urine,. may. UTI. vesicles. amniotic. fetal. substances. gastrointestinal. demonstrated. apical. fetus. of. of. molecular. The. the. excretion. mechanism. also the small. that. a large the. in. proximal. accepted. with. has. located. the. also. on. mucosa. airway.. of. Thus,. maintenance. of. UTI. terminal. pregnancy.. V.. Acknowlegments The. authors. wish. photographic. work.. a research. VI. 1.. grant. M., the. chains. of. inter-a-trypsin. S.Yamazaki. for. supported. in. Pharmaceutical. 329-336,. and. part. by. Co.,. Ltd.. J.,. and. 261;. 305-308,. Biophys. Chen,. Salier,. the. Chem.. two. heavy. Hoppe-Seyler. M.,. inter-a-trypsin. Daveau,. inhibitor.. HepG2. D.R.. and. of proteins. J.-P.:. cells.. Syn-. Biochem.. J.. Oparil, and. S.:. Renal. peptides.. tubular. Kidney. Mt.. the. gene to. the. 195-200,. S.J.T.,. cumulus. evolution. of. physical locus.. assignBiochem.. 1993.. the. L.R.,. Powers,. inter-a-trypsin. extracellular. hyaluronic. and. orosomucoid. McLean,. Proteins. with. 28282-28287,. next. 1174;. Mao,. stabilize. Mouse ƒ¿-1-microglobulin/bikunin. analysis,. gene. Acta. L.:. matrix acid.. J.. N.:. Single-step. R.W.. inhibitor through Biol.. and family. their. direct. Chem.. 269;. 1995.. Chomczynski,. extraction.. proteoglycan the. Diarra-Mehrpour,. hepatoma. Peterson,. and. Larsen,. isolation. A links. 1979.. L.,. binding. R.,. in. cDNA of. Biol.. Human. catabolism. 271-278,. ment. J.: (UTI). 1989.. and. P.. Sesboue, J. -P.:. F.A.,. Chan,. Mizon,. inhibitor. inhibitor.. maturation. Carone,. and. trypsin. 1989.. Martin,. thesis. S.. urinary. Bourguignon,. precursor:. 6.. Laroui,. to. 16;. 5.. Mr. was. Mochida. related. transport. 4.. from. Balduyck,. M.. 3.. thank study. References. 370; 2.. to This. P. by. acid Anal.. and. Sacchi,. guanidinium Biochem.. method. thiocyanate-phenol-chloroform 162;. 156-159,. 1987.. of. RNA.

(9) Urinary. 7.. Duncan,. S.A.,. Weinstein, pression. of. gut,. embryo:. J.. W., and. for. Proc.. the. of. Natl.. P.,. , Jr.. Ex-. J.E.:. endoderm. Acad.. the. in. Sci .. Lab.. Invest.. Salvesen,. of. a. 17 (Suppl. new. K.,. G.: and. inhibitor 83);. Fritz,. Stracture. H.,. of. 23.. the. USA. man. 91;. ("Mingin"). 1-78,. current. Biol.. Pizzo. 25.. K., K.:. stable. Z.. Huang,. L.,. Bretzel,. G.,. Inter-a-trypsin. protease. Seyler's. in. serum. 357;. M.. 371;. Kimata,. J.. Biol.. J.O.. and. , W. of the. urine.. and acid-. 26.. Hoppe-. K.:. A. serum-derived. heavy. chain. Chem.. 268;. 27. in. the. J.F.,. a proteinase. trypsin. 14.. Acid. Lev, the. inhibitor. inhibitor. Nucl. 13.. R.. and. fetal. in. Lindqvist,. with. Luzzatto,. 1130;. A.C.:. Maradny, Terao,. E. T.:. the 17.. Cell. H., of. Odum,. 19.. Odum,. L.:. 24; 20.. I.: and. 21.. trypsin. of. W. in. and liver. Halim,. A., has. Invest. and. Maehara,. J.,. 31.. M.:. injury. and. effect. 169-172,. Sugita,. fetal. K.. a protective. 38;. hypoxic. early. 1981.. on. 32.. LLC-PK1. inhibitor. of. a human. with. a. 925-930,. unique. inhibitor. cell. Ashida,. trypsin acute. Sumi,. H.,. line.. Int.. Y.,. inhibitor. Kato, on. pancreatitis.. K.. and. pancreatic. C.. serine. proteases. Van. K., Inhibition. and. Digest.. Dis.. Sci.. 29;. 35.. Chawla,. R. spectrum. and. Travis, of. native. Wachter, inter-alphaBiol.. Hayden,. Gardner,. B.,. Chem.. S.,. Gadotti,. Mcguire, and. development.. of. the. P.. and. plasminogen. Ann.. NY.. absorptive. intestine. of. of. specific. the. rat.. Acad.. epithelial. cells. J.. 101;. Anat.. Y.. and. Stern,. in. the. in. of the and. mRNA.. transitions. Cell. and 86;. ,. relation. to. the. carbamoylphosphate J.. secreted. Boer,. transcription in. 26;. Raman,. 20-31,. 1994.. and. Rutter,. R.K. during. rat. pancreatic. 1980.. Structure Biol.. De. Developmen-. liver-enriched. 784-794,. W.: gene.. 1996.. J.L.M., A.F.M.:. Histochem.. Biol.. of. during. 162-172,. LAP/LIP. R.J.,. human. treatment. domain-containing. 156;. a-fetoprotein. Gebhard,. of. Chem.. the. human ƒ¿1-. Hoppe-Seyler. 371;. 1990. T., trypsin. 227-236,. 98:. 1977.. of Kringle. Anat.. DBP. synthesized. and. Wakayama,. tion. DNA Biol.. on. on. 747-754,. Moorman. Macdonald,. J.. H.. derived. Mol.. Studies. Vermeulen, and. expression. lactase. Protein. Inter-ƒ¿-. Role. albumin,. G.A.,. 11;. Acta.. C/EBP,. and. A.: modification. epithelial-mesenchymal. M.J.B.,. of. Nest. Its. Res.. W.H.. LF-B1,. and. among. J.. Takada, 1.. C.D.:. in. Hoff,. changes. J.:. sequence. electrophoresis.. Thromb.. Lamers,. Vetr,. gel. development.. den. Urinary Kwon,. acid.. 1185-1196,. enzymes. neural. by. microglobulin-bikunin. Honjo,. P.W., human. activators. inhibitor.. development.. Biochem.. G.,. K.,. structure. Takada,. Thery,. W.J.:. and ƒ¿1J.. Reisinger,. proteins.. Friedman,. Detection. trypsin with. Van. Exp.. 1975.. synthase 33.. 34.. urinary. separated. factors. chemical. 1990.. inter-a-trypsin. hepatoma. H.,. E.M.:. expression. 22;. Embryol.. different. S.,. small. fragments. tal cells.. three. 1987.. The. Southern,. P.A.J.,. Cytoprotective. to. during. 1967.. embryonic. 1994.. J.. of. 963-970,. in. J.:. urinary. 1984.. inhibitor.. 30.. of. apparatus. 1992.. developing. 503-517,. Biochem.. during. 133-142,. inhibitor. Biochem.. experimental. 29.. 1994.. Kosuzume,. Effects. Potempa,. of. 1992.. H.,. 26-33,. N.,. T.,. the. urine. 215;. Obstet.. intestine. Kastern,. differentiation. Biosynthesis. 215-222,. Ohnish,. M.,. 1992.. against. in. the. 63-67,. Res.. Shawdunn, of. 1972.. inhibitor.. Inter-a-trypsin. microglobulin. by. 522-424,. co-expression. trypsin. J.. 28.. HC).. inhibitors 32-40,. 667;. embryos.. Differentiaton. cloning. Plasminogen. Sci.. invasion:. implanting. kidney.. K.,. Christensen,. activator. J.-D.:. and. M.:. rat. cDNA. Verrall,. A.:. 57-68,. inter-a-trypsin. Nakanishi,. Int.. of inter-ƒ¿-. of. 411-412,. L.:. structure.. domain. mRNA. (protein. Altieri,. Kanayama,. ulinastatin 68;. The. al-microglobulin:. Gynecol.. Nakahama,. Nephron. T.,. Tissue. Urinary. amnion.. effects. 18.. E.,. HI-30. absorption 177;. Hepatocyte. development. 16.. Protein. chain. Acta. the. M.P.:. W.:. S.,. Trends. Vassalli,. reabsorption. the. discloses. N.W.,. and. and. Cheignon,. Hochstrasser,. 368;. Haffke,. a family. 1980.. Gebhard, inhibitor. D.. remodeling. ovaries. tubular of. T.,. of. 1989.. and. 157-175,. Krystosek,. 1986.. Science. Rat. light. Biophys.. D.:. Bratt,. B.:. the. to. 7839-7850,. utero.. A.,. Kotick,. 58;. volume.. superfamily.. Belin, tissue. mouse. and. development. Schreitmuller,. D.,. 26725-26730,. encodes ƒ¿-1-microglobulin. 14;. Orlic,. rat. related. also. Res.. Akerstrom,. 15.. Polazzi,. J. filter. Seeds,. J.,. 2471-2479,. Schaeverbeke,. emergence. inhibitor. in in. 109;. fluid. 1990.. Huarte,. localization. trypsin. inhibitor:. activators. Biol.. amniotic. 1966.. 435-439,. -P.,. 1989.. and. protease. 15;. Hoppe-Seyler. is the. 606-610,. Inter-ƒ¿-trypsin. A.. and. 15109-15114,. swallowing. Kunitz-type. Sappino,. E.. 1993. Kaumeyer, for. -P.:. Sci.. Cell. 264;. Fetal 28;. Biochem.. foetal. 1976.. (SHAP). inhibitor.. Hilla. and. 153-162,. and. protein. inter-a-trypsin. H., as precursor. human. Chem.. Yoneda,. Feuth,. inhibitor. inhibitor. Physiol.. hyaluronan-associated. 12.. the. Morph.. Hochstrasser, Lempart,. J.. within. glomerular. 1990.. Chem.. Gynec.. Salier,. J.. proposi-. Hoppe-Seyler. Biol.. Plasminogen. ,. (inter-aand. 565. J.A.:. mRNA. J.J.,. state. Chem.. .. 1965.. Enghild,. inter-a-inhibitor. pre-a-inhibitor:. terminology.. in. J.. Pritchard, Obstet.. in. endoderm. in Rat Embryo. forms. 22.. extraembryonic. the. primary. trypsin. Hochstrasser,. inhibitor). 13-22,. 11.. tissue. marker. Urinary. Clin.. Gebhard,. trypsin. 10.. in. Hoodless,. 24.. H.J.:. Scand.. tion. Darnell. Inhibitor. 1994.. Faarvang,. S.V.. a. W .,. and. HNF-4. nephrogenic. is. glastocyst.. 7598-7602,. Chen,. R.F. factor. and. HNF-4. implanting. 9.. K.,. Bachvarova,. transcription. endoderm,. 8.. Manova,. D.C.,. Trypsin. the. kidney 1996.. Mizushima, inhibitor: of. S., production. the. rat.. Acta. Hirose, in. J. the. Histochem.. liver. and and. Iseki,. S.:. reabsorp-. Cytochem.. 29,.

(10)

Updating...

参照

Updating...

関連した話題 :

Scan and read on 1LIB APP