Analysis of expression patterns of microglia-related factors in the mv rat

Introduction

It was demonstrated in section 1-1 that microglial activation is confined to the gray matter whereas morphological abnormalities of myelin sheaths were more apparent in the white matter of the mv rat. These results raise the possibility that the microglial activation is more than a simple reaction to the myelin destruction in the mv rat.

Microglia/macrophages are involved in the pathology of multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE) by the production of various kinds of cytokines. Activated microglia and infiltrating macrophages in demyelinating lesions of MS and EAE show a strong upregulation of TNF-α, IL-1β and IL-6 (Benveniste, 1997; Raivich and Banati, 2004). These cytokines have been proved to have detrimental effects on CNS demyelination, one of which is the production of reactive oxygen and nitrogen species (Jack et al., 2005; Raivich and Banati, 2004). Inducible nitrogen oxide synthase (iNOS) is

upregulated in astrocytes and macrophages in MS patients (Jack et al., 2007), and its product nitric oxide (NO) is thought to be toxic to myelin (Raivich and Banati, 2004; Smith and Lassmann, 2002). Transforming growth factor-β1 (TGF-β1) plays an important role as an immunosuppressive cytokine in MS and EAE (Prud'homme and Piccirillo, 2000) and is upregulated in infiltrating macrophages, activated microglia and reactive astrocytes in MS (De Groot et al., 1999; Moreels et al., 2008).

In this section, the expression of several cytokines which are known to be related with microglial activation in human and animal myelin diseases, was investigated to understand the role of activated microglia in the gray matter of the mv rat.

Materials and Methods

Reverse transcription PCR (RT-PCR) for microglia-related factors

Cervical spinal cords of wild-type and mv rats at 4 and 6 weeks of age were removed and dissected into the white and gray matter. Total RNA was isolated using SV Total RNA isolation system (Promega) according to the manufacturer’s instructions. One μg of total RNA was transcribed with Superscript II reverse transcriptase using random hexamers (Invitrogen). To examine gene expression of TNF-α, IL-1β, and IL-6, first-strand cDNA was amplified by a thermal cycler (PC 707; Astec, Japan) with GoTaq DNA polymerase

(Promega). To determine relative expression levels of iNOS and TGF-β1 genes, quantitative real-time PCR was performed with a SYBR Green PCR master mix (Toyobo, Japan) in a Linegene system (Bioflux, Japan). Details of specific primers are listed in Table 1. β-Actin was used as an internal control. The cycling condition for real-time PCR was as follows: 1 cycle of 95°C for 1 min, followed by 45 cycles of 95°C for 15 sec, 60°C for 15 sec, and 72°C for 30 sec. Relative expression levels were calculated based on threshold cycle (Ct) value (comparative Ct method).

Western blot for iNOS protein

Thoracic spinal cords of wild-type and mv rats at 10 weeks of age were removed and

homogenized in a cell lysis reagent (CelLytic MT; Sigma). After centrifugation at 13,000 g for 10 min, protein concentrations were determined by the Bradford Protein Assay (BioRad, USA). Ten μg of total proteins were separated on 7.5% polyacrylamide gels and transfered to polyvinylidene difluoride membranes (BioRad). Membranes were incubated with mouse anti-iNOS antibody as described elsewhere (Nakamura et al., 2006) and mouse anti-β-actin antibody (Sigma) at 4°C overnight, and were treated with Histofine simplestain MAX PO for 30 min. Signals were visualized with ECL reagent (GE Healthcare, USA) and quantified with a luminescent image analyzer (LAS-3000; Fujifilm, Japan). β-Actin was used as an internal control.

Immunohistochemistry for iNOS

Lumbar spinal cords of control and mv rats at 6 weeks were sampled as previously described (see Section 1-1, Materials and Methods). Ten-μm frozen sections were cut using a cryostat. Sections were incubated with 10% normal goat serum in PBS for 30 min, treated with mouse ant-iNOS antibody (Nakamura et al., 2006) at 4°C overnight, and incubated with Histofine simplestain MAX PO for 45 min. Signals were visualized with DAB.

Statistical analysis

Data are presented as means ± standard deviation. Statistical analysis was performed using one-way analysis of variance followed by Tukey’s test. A value of P less than 0.05 was considered statistically significant.

Results

Microglial activation is associated with increases in TGF-β1 and iNOS expression

To gain further insights into the role of activated microglia in the mv rat, the

expression of several factors associated with microglial activation was examined. Expression levels of TGF-β1 mRNA were significantly increased in the gray matter of the mv rats

compared with wild-type rats at 6 weeks (Fig. 9A). Expression levels of iNOS mRNA were not significantly changed between wild-type and mv rats at either age (Fig. 9B). There were no obvious changes in the expression of TNF-α, IL-1β, and IL-6 mRNA between wild-type and mv rats (data not shown). Western blot analysis demonstrated a significant increase in the expression of iNOS protein in the spinal cord of the mv rats at 10 weeks (Fig. 10A).

Immunoreactivity for iNOS was weakly detected in astrocytes in the white matter of control rats at 6 weeks (Fig. 10B, D), whereas it was markedly increased in activated astrocytes of both the white and gray matter of mv rats (Fig. 10C, E).

Discussion

The results of this study demonstrated increased expression of TGF-β1 mRNA in the spinal cord gray matter of the mv rat, which is coincident with the microglial activation. TGF-β1 is normally present at low levels in the normal CNS tissues, while it is highly upregulated

in various cell types, such as activated microglia and astrocytes, and neurons in many

neurodegenerative diseases (Finch et al., 1993; Kiefer et al., 1998; Vivien and Ali, 2006; Zhu et al., 2000). An in vivo analysis of TGF-β1-deficient mice revealed that lack of TGF-β1 results in a prominent microgliosis in the brain, suggesting a role of TGF-β1 in regulating

microglial activation (Brionne et al., 2003). This finding is further supported by in vitro studies demonstrating that TGF-β1 regulates microglial activity by inhibiting iNOS

expression (Lieb et al., 2003; Vincent et al., 1997) and NO production (Herrena-Molina and von Bernhardi, 2005; Lieb et al., 2003). These data suggest that TGF-β1 may play a key role in microglial activation in the mv rat.

ATRN is expressed on the cell surface of peripheral blood monocytes and involved in their function in cell adhesion and release of cytokines including TGF-β1 (Wrenger et al., 2006). Since microglia are believed to be derived from bone marrow during embryogenesis, it is likely that ATRN may also be involved in microglial function, and that the lack of ATRN may affect the function of microglia in the mv rat. Recent studies demonstrated abnormal recruitment of macrophages/microglia during very early postnatal development and

subsequent activation of microglia in the brain of the zitter rat, suggesting that macrophage/

microglial lineage may contribute to myelin alterations in the zitter rat (Kadowaki et al., 2007; Sakakibara et al., 2008). Further studies on the cytokine network should be needed to understand the molecular mechanism and roles of microglial activation in the Atrn-mutant animals.

The results of this study showed that expression of iNOS protein is significantly increased in activated astrocytes both in the white and gray matter of the mv rat. However, the author failed to detect a difference in iNOS mRNA levels between wild-type and mv rats. This may be due to the sensitivity of the real-time PCR method, since the expression levels of iNOS in the spinal cord of both groups were very low (more than 30 in Ct value). In the demyelinating lesions of MS and EAE, iNOS is induced mainly in reactive astrocytes and microglia/macrophages (Hill et al., 2004; Jack et al., 2007; Liu et al., 2001; Raivich and Banati, 2004). iNOS produces a large amount of NO, and NO and its reactant with

superoxide, peroxynitrite, have been known as toxic factors for oligodendrocytes (Boullerne

and Benjamins, 2006; Smith et al., 1999) and mediators of damage to myelin (Bizzozero et al., 2004; Boullerne and Benjamins, 2006; Jack et al., 2007; Smith et al., 1999). The results of this study suggest that the activated astrocytes in the mv rat may be involved in the

progression of myelin alterations by NO production.

Summary

The expression of microglia-related cytokines in the spinal cord of the mv rat was investigated to explore the role of activated microglia in the gray matter. Increased expression of TGF-β1 was closely associated with the microglial activation, which may indicate a key role of this cytokine in the regulation of microglial activation in the mv rat. iNOS expression was markedly increased in activated astrocytes both in the white and gray matter of the mv rat, suggesting that the activated astrocytes in the mv rat may be involved in the progression of myelin alterations by the production of NO, a factor toxic to oligodendrocytes and myelin.

Table 1. Primers for RT-PCR analysis

Gene Primer sequence Accession number

TNF-α sense: 5’- TGTCTACTGAACTTCGGGGTG -3’ X66539 antisense: 5’-GAGGCTGACTTTCTCCTGGTA-3’

IL-1β sense: 5’-AAGCCTCGTGCTGTCGGACCC-3’ M15131 antisense: 5’-TCCAGCTGCAGGGTGGGTGTG-3’

IL-6 sense: 5’-ATGAAGTTTCTCTCCGCA-3’ M26744

antisense: 5’-GGGGTAGGAAGGACTATT-3’

iNOS sense: 5’-CCCTAAGAGTCACAAGCATCAAAAT-3’ D44591 antisense: 5’-GGTTCCTGTTGTTTCTATTTCCTTTGTTAC-3’

TGF-β1 sense: 5’-CTTCAGCTCCACAGAGAAGAACTGC-3’ X52498 antisense: 5’-CACGATCATGTTGGACAACTGCTCC-3’

β-Actin sense: 5’-TAAAGACCTCTATGCCAACAC-3’ BC063166 antisense: 5’-CTCCTGCTTGCTGATCCACAT-3’

TNF-α; tumor necrosis factor, IL-1β; interleukin-1β, IL-6; interleukin-6, iNOS; inducible nitric oxide synthase, TGF-β1; transforming growth factor-β1

Figure Legends

Fig. 9

Expression levels of TGF-β1 (A) and iNOS (B) mRNA in the cervical spinal cord of wild-type (WT; white column) and mv rats (black column) at 4 and 6 weeks. Data are presented as the mean ratio of target to reference gene (n=3 in each group). β-Actin is used as an internal control. Expression levels of TGF-β1 mRNA are significantly increased in the gray matter of mv rats at 6 weeks compared with control rats (A). Expression levels of iNOS mRNA do not differ significantly between wild-type and mv rats at either age (B). ^*P<0.05 by Tukey's test.

Fig. 10

Expression levels of iNOS protein in the thoracic spinal cord of wild-type (WT; white column) and mv rats (black column) at 10 weeks (A). Data are presented as the mean ratio of iNOS to β-actin levels (n=3 in each group). β-Actin is used as an internal control. Expression levels of iNOS protein are significantly increased in the mv rats (A). Immunohistochemistry for iNOS in the lumbar spinal cord of control (B, D) and mv rats (C, E). Compared with control rats (B, D), iNOS immunoreactivity is markedly increased in activated astrocytes of both the white (C) and gray (E) matter of mv rats. Bar: 20 μm (B-E).

Plate III

Fig. 9

gray matter white matter

*

TGF-β1 iNOS

gray matter white matter

B A

0 1 2 3

4 wks 6 wks 4 wks 6 wks

relative expression

WT mv

0 0.5 1 1.5 2 2.5

4 wks 6 wks 4 wks 6 wks

relative expression

WT mv

Fig. 10

0 0.5 1 1.5 2 2.5

cont, 10 wks mv, 10 wks

relative expression

iNOS

β-actin

*

A

B

E D

C

control mv

white mattergray matter