7. C)entrifuge for 10 min at 12,000 rpm (‑12,000 x g), transfer the supernatant to
3.5 p1 (‑1mg) pKKT427
M 1
Fig. 5. P‑BKatE
(0.8%
agaroSe, 100V,30min).
Lane M: i EcoTmarker, lane 1:P‑BKatE.3.3 Construct destination Vector
Constructed the destination vector PGUOO 1.
3.3.1 Digest pKKT427
Digested pKKT427 with StuI
(Takara)
at 37oC for 16 hours.Plasmid pKKT427 is showed in Fig. 6.
The components of reaction:
2 p1 10xMBuffer l3 BllddH20
I.5 Lil StuI
Lined pKKT427 was purified with PEG.
Fig. 6. The map ofplasmid pKKT427.
3.3.2 Construct destination vector pGUOO1
1. Ligation lined pKKT427 with rfcA
(Gateway
reading &amecassetteA)
Ligated lined pKKT427 with rfcA
(‑1.7kb)
at 16oC for 30min with DNA Ligation Kit. The components of reaction:1 Lil lined pKKT427
3 pl Gateway reading frame cassetteA
4 pl ligate solution .
2. Transformation One Shot ccdB Survival TIR E. coli.
Add 2 pl ligated mixture into One Shot ccdB Survival TIR E. coli.
spread the 50 pl culture selective plates
(cmR)
and incubateovemight
at 37oC.3. Check the plasmid pGUOO1 with PCR.
Po1ymerase: GO Taq
Template: PGUOO I
Cycling step:
Pre‑denaturation :
Denaturation :
Amealing :
Extension :
95oC, 2min
95oC, 1 min‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑
48oC, 1min‑‑‑‑‑‑X 30 cycles‑‑‑
68oC, 2min‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑
Per product rfcA's length was
‑1.7kb
(Fig. 7).
I M
Fig. 7. RfcA
(0.8%
agarose, 100V,30min).
Lane M: i EcoT marker, lane 1:RfcA.3.4 Construct the plasmids
3.4.1 BPreaction
Transfer P‑BKatE into the vector PDONR P1
‑P5r.
Trahsfer Hup‑terminater into the vector PDONR P5‑P2.
The components of reaction:
Fragment PDONR vector TE buffer
P‑BKatE 1 p1
(‑80ng)
1 p1 6LllHup‑teminator 1 p1
(‑80ng)
1 p1 6p1The PDONR: :Hup‑terminater, PDONR::P‑BKatE by BP reacted were checked by PCR with GOTaq. Fig. 8.
Template: PDONR:P‑BKatE
r
Primer:
PDONR:P‑BKatE‑‑ Hup‑f and BKatE‑r Cycling step:
Pre‑denaturation :
D enaturation :
Annealing :
Extension:
95oC, 2min
95oC, 1min‑‑‑‑‑‑‑‑‑‑‑‑‑‑
55oC, 1min‑‑i‑X 30 cycles‑‑‑‑‑
68oC, 2min20sec‑‑‑‑‑‑.‑‑‑‑‑‑‑‑‑‑‑‑
Template: PDONR:Hup‑terminator
Forward primer: Tem‑f
Forward primer: Tem‑r
Cycling step:
Pre‑denaturation :
D enaturation :
Amealing :
Extension :
95oC, 2min
95oC, 1 min‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑‑
60oC, lmin‑‑‑‑‑‑X 30 cycles‑‑‑‑‑
68oC, 1 5sec‑‑‑‑‑‑‑‑‑‑‑‑‑‑
1 2 3 4 5 6 7 8 9 M
Fig, 8a. PDONR::P‑BKatE
(0.8%
agarose, 100V,30min).
Lane M: i EcoT marker, lane 4‑6: PDONR: :P‑BKatE.Fig. 8b, PDONR:Hup‑terminator
(2%
agarose, 100V,30min).
Lane M: lOObpmarker, lane 1:PDONR:Hup‑terminator.
3.4.2 LR reaction
Ligated Hup‑terminater and P‑BKatE by LR reaction.
The components of reaction:
PDONR PGUOO 1 PDONR: TE buffer
Hup‑terminator
pBCATOO1
1pl(‑10hol) 1p1(‑20ho1) 1pl(‑10hol)
5p1The plasmids, pBCATOOl were checked by PCR with GOTaq. Fig. 9.
M l 2 3 4 5 6 7 8
Fig. 9. pBCATOO1
(0.8%
agarose, 100V,30min).
Lane M: i EcoT marker, lane 4‑6:pBCATOO1.
3.5 Analyze the sequences
The plasmid pBCATOOl is showed below
(Fig. 10):
...aacgcgggttTTcgcagaaaCatgCgCtagfaTcLTftgatgacaacatgg actaagcaaaagtgcttgtcccctgacccaAGAAGGatgcttt4TG‑..
".ccttctgctcgtagcgattacttcgagcattaCtgaCgaCaaagaeCC(
gaccgagatggtcggggtctttttgttgtggTgCtgtgaCgtgttgtCea
‑.Fig. 10. The map of pBCATOOl construction using the Gateway system. P: hup
promoter; T: hup teminator; katE: B. subtilis heme‑dependent catalase; Spr:
spectinomycin resistance; repB:
Bljidobacterium
replication initiation; ColEl ori:colicine El
origin
of replication; attB1, attB2, attB5: Gateway system sites; bold:palindromes; italic: proposed ‑35 and ‑10; uppercase: proposed RBS; uppercase italic:
the initiation codon̲
3.5.1 Hup‑promoter
The Hup‑promoter sequence is showed below:
tagatgtgaaaacccttataaaacgcgggt
‑35
gaaacatgcgctaa;i;*gatgacaacatggactaagc
‑10 aaaagtgcttgtcccctgacccaagaaggatgcttt
RBS
The proposed promoter
(‑35,‑10)
and a ribosomal binding sequence were boxedand underlined with a double line, respectively.
3.5.2 Hup‑terminator
The Hup‑terminator sequence is showed below:
ccttctgctcgtagcgattacttcgagcattactgacgacaaagaccccgaccgatggtcggggtctttttgttgtggt
gctgtgacgtgttgtccaaccgtattattccggactagttcagcg
The regions of dayd symmetry are indicated by horizontal arrows and the following T‑rich sequence is showed by a double line.
3.5.3 Catalasegene
Comparison of the B‑KatE
(Heme‑catalase)
of B. subtilis GTCO1672 with B.subtilis subsp. subtilis st7: 168 indicated no mismatched.
3.6 The catalase activity inE. coli UM255
Escherichia coli UM255
bro
leu rpsL hsdM hsdR endl lacy katG2 katE::Tn10recA)
was used as a host strain for the gene cloing of catalase. Transformated E. coli
uM255 with pBCATOO1. Detected activity of catalase by adding H202 tO the Plate
colonies. See the SDS‑PAGE in the Fig. 12.
1n Fig. 1 1, catalase activitywas observed in E. colt UM255.
Fig. 1 1. The presence ofE. colt UM255
bBCATOO1)
catalase activity leads to bubble formation resulting &om the transformation of H202 tO H20 and 02.3.7 The catalase activity in B. Longum 105‑A
The catalase activity was observed in E. colt UM255, then, detected the catalase
activity in B. longum lO5‑A.
3.7. 1 PBCATOO I
(Heme‑catalase)
activityThe gene encoding the Heme‑dependent catalase
(pBCATOO1)
of B. subtilis was introduced into B. longum 105‑A. Transformated B. Longum lO5‑A was grown in MRS medium. Catalase activity was checked by adding H202. No bubble wasobserved. Then, transformated B. longum 105‑A was grown in MRS medium added Hemin
(10LtM).
Checked the catalase activity with the method 2.7.1.We then determined the catalase protein in A colt UM255 and B. longum 105‑A
cultures on SDS‑PAGE. In the fractions, one ‑77 kDa migrating band was detected and present in E. colt
UM255bBCATOO1)
extract, suggesting that it couldUM255 with pBCATOO1. Detected activity of catalase by adding H202 tO the plate
colonies. See the SDS‑PAGE in the Fig. 12.
In Fig. ll, catalase activity was observed in E. coli UM255.
T‑I I
Fig. 1 1. The presence ofE. coli UM255
bBCATOO1)
catalase activity leads to bubble formation resulting from the transformation ofH202 tO H20 and 02.3.7 The catalase activity in B. longum 105‑A
The catalase activity was observed in E. coli UM255, then, detected the catalase
activity in B. longum 105‑A.
3.7. 1 pBCATOO1
(Heme‑catalase)
activityThe gene encoding the Heme‑dependent catalase
bBCATOO1)
of B. subtilis was introduced into B. longum 105‑A. Transformated B. longum 105‑A was grown in MRS medium. Catalase activity was checked by adding H202. No bubble wasobserved. Then, transformated B. longum 105‑A was grown in MRS medium added Hemin
(10pM).
Checked the catalase activity with the method 2.7.1.We then determined the catalase protein in E. coli UM255 and B. longum 105‑A
cultures on SDS‑PAGE. In the fractions, one ‑77 kDa migrating band was detected and present in E. coli
UM255bBCATOO1)
extract, suggesting that it couldcorrespond to BKatE. No corresponding band was detected in B. longum 105‑A. The protein ofcatalase was checked by SDS‑PAGE
(Fig. 12).
Fig. 12. Catalase in E. coli UM255 and B. longum lO5‑A on SDS‑PAGE
(10%
running gel, 4% stacking
gel).
BKatE(Heme‑catalase
from B.subtilis)
in E. coliUM255 was visible. BKatE in B. longum 105‑A was invisible. Lane M: Protein MW Maker
(Daiichi),
lane 2: E. coli UM255bBCATOO1),
lane 4: B. longum 105‑A, lane 6:B. longum 105‑A
bBCATOO1).
In Fig. 13, catalase activity was observed in B. longum 105‑A.
a)
B. longum 105‑AbKKT427)
B, longum lO5‑A
O)BCATOO1)
r
=
l3
‑0
LI
A En
E
〜
=
tJ
>
:i
O<
0 u)
〜
7;
1I
ql
O 0
A B C
Fig. l3. Comparative assay of KatE activity. The degradation of H202 Was measured in
crude protein extracts. A: B. longum 105‑A harboring pBCATOO1
(hup promc.ter);
B: B,longum 105‑A harboring pBCATOO2
kap promoter);
C: B. longum 105‑A harboringpBCATOO3
(BkatE
nativepromoter).
Error bars correspond to the standard errors of themeans.
The catalase activity data see below:
Table S2. The catalase activities of crude extract.
(U/mg)
B. longum B. longum B. longum
Hemina . 105‑A
(wild
105‑A 105‑Atype) bKKT427) bBCATOO
1)
nd nd 39
nd nd nd
iEgd:e:r:aidi1;;:eenrco:efg e(c;e;nsdilttnioa;e.d?ilBE6;fg??oT
em in in/ m edium '3.8 Short‑term H202 exposure OfB. longum 105‑A
The production of BKatE by B. longum 105‑A effect under oxidative stress
conditions was evaluated by oxidative stress induced by adding H202.
B. longum 105‑A
(pBCATOO1)
was incubated for 1 h in MRS medium in the presence of 4.4 mM H202 concentrations to determine discriminating conditions that would allow the evaluation of the effect of BKatE on the survival of exponentially growing cells(OD660‑0.6)
or stationary‑phasep cells(OD660‑1.0).
The production of BKatE in B. longum 105‑A conferred improved survival rates were better H202resistance than the control strain. The survival of exponentially growing cells and stationary‑phase cells in response to 4.4 mM H202 Was increased 120‑fold
(The
datasee
below).
CFU/mL and survival rates after H202 exposure for 1 h
Gro wth phase
Strain
CFU/mL after H202 exposure
Survival
OmMH202 4.4mMH202 rateSa
Survival rate increasesb Exponential
0D660 0.6
S tationary OD660 1.0
B. longum 105‑A
bKKT42 7)
B. longum 105‑A
(PBCATOO
1)
B. longum 105‑A
(pKKT42 7)
B. longum 105‑A
(PBCATOO
1)
7.00x 108
(iO.34)
8.00x 108
(iO.16)
1.68x 109
(j=0.22)
1.56x 109
(iO.34)
1.20x 105
(iO.20)
1.64x 107
(iO.26)
2.lox 106
(iO.40)
2.00x 108
(j=0. 14)
0.00017
0.021 120 fold
0.0013
0.13 103 fold
a Survival rates were generated by comparing the colony counts for 0 versus 4.4 mM H202 exposure for 1 h at 37oC.
b survival rate increases were compared for B. longum 105‑A
(pBCATOO1)
and B.longum 1 05‑A
bKKT427).
*Data are the means i standard deviations of three independent experiments.
3.9 Long‑term 'with aerated cultures ofB. longum 105‑A
B. longum is known to accumulate H202 during its growth in the presence of 02.
We therefore also compared the long‑term survival ofB. longum 105‑A
(pBCATOO1)
during aerated growth. Since BKatE requires exogenous hemin for activity, these
aerated cultures supplemented with hemin will lead to respiratory metabolism.
3.9.1 0D
The OD values under aerobic and anaerobic condition were assayed.
0 1 0 20 30 40 50
Time (h)
Fig. 14. Cultured B. longum 105‑A
bKKT427
orpBCATOO1)
under aerobic oranaerobic conditions. Growth
(OD660)
Of the cultured B. longum 1 05‑A. Closed circle(.),
B. longum 105‑AbKKT427)
cultured under aerobic conditions; open circle(o),
B. longum 1 05‑A
bBCATOO1)
cultured under aerobic conditions; closed triangle(A),
B. longum 1 05‑A
bKKT427)
cultured underahaerobic
conditions; closed square(‑),
B. longum 1 05‑A
(pKKT427)
cultured using exogenously added catalase(3000
U/mLmedium)
under aerobic conditions; open square(u),
B. longum 105‑A(pKKT427)
cultured using exogenously added catalase
(100
U/mLmedium)
under aerobicconditions. The results presented correspond to the averages of three different assays.
Error bars correspond to the standard errors of the mean value.
3.9,2 CFU
The CFU under under aerobic and anaerobic condition were assayed.
9
A
25E !g5
7
5
3
10 20
Time (h)
30 40 50
Fig. 15. Cultured B. longum lO5‑A
bKKT427
orpBCATOO1)
under aerobic oranaerobic conditions. Counts of B, longum 105‑A cultured under aerobic conditions.
Closed circle
(.),
B. longum 105‑AO)KKT427)
cultured under aerobic conditions; open circle(o),
B. longum 105‑AbBCATOO1)
cultured under aerobic conditions; closed square((),
B. longum 105‑A(pKKT427)
cultured using exogenously added catalase(3000
U/mLmedium)
under aerobic conditions; open square(u),
B. longum lO5‑AbKKT427)
cultured using exogenously added catalase(100
U/mLmedium)
underaerobic conditions. The results presented correspond to the averages of three different assays. Error bars correspond to the standard errors of the mean value.
3.9.3 LIVE/DEAD
The live and dead cells under aerobic and anaerobic condition were assayed using flow cytometry.
8
A
W J
? E
Bi7 jP
V
6
10 20 30 40 50
Time (h)
Fig. 16. Cultured B. longum 105‑A
bKKT427
orpBCATOO1)
under aerobic oranaerobic conditions. L/D assay of B, longum 105‑A cultured under aerobic conditions. Closed circle
(.),
BJongum 105‑AbKKT427)
cultured under aerobic conditions; open circle(o),
B. longum 105‑A(pBCATOO1)
cultured under aerobic conditions; The results presented correspond to the averages of three different assays.Error bars correspond to the standard errors of the mean value.
3.9.4 H202 accumulation
The H202 accumulation under aerobic and anaerobic condition were assayed.
0.12
A
2 E
〜
0
L5
E o
O
oNo
〜
I
o
.06 .04 .02 0
1 0 20 30 40 50
Time (h)
Fig. 17. Cultured B. longum 105‑A
(pKKT427
orpBCATOO1)
under aerobic oranaerobic conditions. H202 accumulation by B. longum 1 05‑A cultured under aerobic conditions. Closed circle
(+),
B. longum, 105‑A(pKKT427)
cultured under aerobic conditions; open circle(p),
B. longum 105‑A(pBCATOO1)
cultured under aerobic conditions; The results presented correspond to the averages of three different assays.Error bars correspond to the standard errors of the mean value.