近畿大学学術情報リポジトリ

全文

(1)Studies on the essential two-component system YycG-YycF of. Bacillus subtilis: the development for bacterial signal transduction inhibitors. ili:.*~ *~~ .~,p]f~f3J htffl1:.~1t~.w::rt (m~:. pgifg:. ftj(~~~~).

(2) Doctoral Dissertation. Studies on the essential two-component system YycG-YycF of Bacillus subtilis,: the development for bacterial signal transduction inhibitors. Takafumi Watanabe Graduate School, Kinki University Division of Agricultural Science (Major: Applied Bioscience).

(3) Studies on the essential two-component system YycG-YycF of Bacillus subtilis: the development for bacterial signal transduction inhibitors Takafumi Watanabe. March, 2004 Graduate School, Kinki University Division of Agricultural Science Major: Applied Bioscience (Adviser: Prof. Ryutaro Utsumi). (fox~ §). Submitted to the Graduate School, Kinki University, to fulfill the requirement for the Doctorate Degree..

(4) ABBREVIATIONS. A. Alanine. ATP. Adenosine 5' -triphosphate. ApT. Ampicillin resistant. bp. Base pair (s). BPB. Bromophenol blue. BSA. Bovine serum albumin. cAMP. Cyclic adenosine monophosphate. CAP. Catabolite activator protein. CD. Circular dichroism Chloramphenicol resistant. cpm. Counts per minute. D. aspartic acid. Da. Dalton. DMSO. Dimethyl sulfoxide. DNA. Deoxyribonucleic acid. DSS. Disuccinimidyl suberate. DTT. Dithiothreitol. EDTA. Ethylenediaminetetraacetate. HEPES. N -2-H ydrox yethylpiperazine-N' -2-ethanesulfonic acid. His (H). Histidine. HK. Histidine kinase (s). HPLC. High-performance liquid chromatography.

(5) IC so. A half-maximum inhibitory concentration. Km". Kanamycin resistant. LB. Luria-Bertani. MAPK. Mitogen activated protein kinase. MBP. Myelin basic protein. MIC. Minimum inhibitory concentration. MRSA. Methicillin resistant Staphylococcus au reus. MS. Mass spectrometry. NMR. Nuclear magnetic resonance Neomycin resistant. OD. Optical density. ORSA. Oxacilline resistant Staphylococcus au reus. PAGE. Polyacrylamide gel electrophoresis. PCR. Polymerase chain reaction. Pro (P). proline. PVDF. Polyvinylidene difluoride membrane (s). RR. Response regulator (s). SDS. Sodium dodecyl sulfate. TCA. Trichloroacetic acid. Tc f. Tetracycline resistant. TCS. Two-component system (s). Tris. Tris (hydroxymethyl) aminomethane. VRE. Vancomycin resistant Enterococcus faecalis.

(6) CONTENTS. CHAPTER I. Introduction. CHAPTER II. Molecular characterization of the essential two-component system, YycG-YycF in Bacillus suhtilis. 1. 6. CHAPTER III Sensitive genetic screening method for inhibitors of the essential two-component system, YycG-YycF. 27. CHAPTER IV Conclusion. 47. ACKNOWLEDGEMENTS. 50. REFFERENCES. 52. PUBLICATIONS. 60.

(7) CHAPTER I Introduction. An antibiotic was one of the great discoveries of the 20th century. However, the administration of this class of drug has been compromised by the emergence of new antimicrobial resistant bacterial strains. The first clinical antibiotic, penicillin, was introduced in the mid 1940s, whereas the existence of resistant mutants was recognized within 2 years after its introduction [Walsh, 2000]. Currently, one of the most serious problems being encountered in the clinic is an increasing number of bacterial strains with resistance to vancomycin, which is often the antibiotic used as a last resort. Multi-antibiotic. resistant. Staphylococcus. aureus. gram-positive (MRSA),. strains,. including. vancomycin-resistant. methicillin-resistant MRSA,. and. vancomycin-resistant Enterococci (VRE), are spreading at an alarming rate [Cohen, 2000]. Consequently, novel approaches are urgently required to treat such bacterial infections. The complete genome sequences of several bacterial strains, including the clinically important MRSA, vancomycin-resistant MRSA [Kuroda et aI., 2001], and Escherichia coli 0157 [Yokoyama et aI., 2000, Perna et aI., 2001], have been published,. and these genome projects have provided numerous bacterial genes coding for proteins that could potentially serve as targets for novel antibacterial compounds [Moir et aI., 1999]. Indeed, the bioinformatics of those strains may provide a basic idea for establishing a structure- and mechanism-based design approach as innovative antimicrobial therapies. The emergence and spread of hospital acquired multi drug resistant bacteria present a need for new antibiotics with innovative mode of action. Advances in molecular.

(8) microbiology and genomics have led. the identification of numerous bacterial genes. to. coding for proteins that could potentially serve as targets for antibacterial compounds. Histidine kinases (HKs) promoted two-component systems (TeSs) are extremely common in bacteria and play an important role in essential signal transduction for adapting to bacterial stress. Since signal transduction in mammals takes place through a mechanism different from that in bacteria, inhibition of HKs could be a potential target for antimicrobial agents.. Inner membrane Histidine kinase (HK). Au tophosphory 1ati on. Response ( ) regulator (RR) ~-l-~. Phosphorylation. ~ /. Regulation of transcription. The promoter region of target genes Fig. 1. Model of two-component system (TeS) .. 2.

(9) Tess are ubiquitous in bacteria and typically comprise a membrane-bound protein (HK) and a cytoplasmic response regulator (RR). Bacteria use these systems to monitor their external environment and adapt so that they can survive (Fig. 1). Before the genomic era, since several TeSs had been characterized and some of these had been shown to be involved in pathogenesis, their potential as novel antibacterial targets was suggested. However, little was known about a number of different systems that existed in a specific pathogen, whether the systems from different pathogens were related and whether there were in vivo essential systems. Genomic sequencing has revealed the entire set of TeSs in a range of bacterial species such as Haemophilus inJluenzae, Helicobacter pylori, S. aureus and Streptococcus pneumoniae. Detailed bioinformatic analysis of these systems demonstrated that homology exists between the TeSs within the same pathogen and from pathogen to pathogen, and that no homologues exist in human. Recently, essential TeSs have been found: YycG-YycF in Bacillus subtilis [Fabret and Hoch, 1998], YycG-YycF in S. aureus [Martin et aI., 1999], YycG-YycF in Table 1. Essential TeSs.. Streptococcus pneumoniae [Lange et aI., 1999, Throup et aI., 2000], YycG-YycF in Strain (genome size). Essential TCS (HK-RR). References. Bacillus subtilis 168 (4.2 Mb). YycG-YycF. Fabret and Hoch, 1998 and Fabret et aI., 1999. Caulobacter crescentus CB 15 (4.0 Mb). CckA-CtrA. Quon et aI., 1996 and Jacob et aI., 1999. DivJ-DivK. Wu et aI., 1998. Enterococcusfaecalis V583 (3.2 Mb). YycG-YycF. Hancock and Perego, 2002. Helicobacter pylori 26695 (1.7 Mb). HP165-HP166. Beier and Frank, 2000. Mycobacterium tuberculosis H37Rv (4.4 Mb). MtrB-MtrA. Zahrt and Deretic, 2000. Staphylococcus au reus Mu50 (2.8 Mb). YycG-YycF. Martin et aI., 1999. Streptococcus pneumoniae R6 (2.0 Mb). YycG-YycF. Lange et aI., 1999 and Throup et aI., 2000. 3.

(10) Enterococcus Jaecalis [Hancock and Perego, 2002], HP16S-HP166 in Helicobacter pylori [Beier and Frank, 2000], MtrB-MtrA in Mycobacterium tuberculosis [Zahrt and. Deretic, 2000] and CckA-CtrA [Quon et al., 1996, Jacobs et aI., 1999] and DivJ-DivK [Wu et aI., 1998] in Caulobacter crescentus (Table 1). YycG-YycF system is also conserved among gram-positive pathogen bacteria such as MRSA and VRE and regarded as novel targets for antibacterial agents. Recently, Howell et ai. found that YycF directly binds to the regulator regions of JtsAZ as well as yocH, which encodes as autolysin. Nucleotide sequence analysis and. site-directed mutagenesis revealed a potential consensus recognition sequence (YycF box) for the YycF, composed of two direct repeats: S'-TGT Aff A Aff/C-NS-TGT Aff A Aff/C-3'. A DNA-motif analysis indicates that there are potentially up to 10 genes within the B. subtilis YycG-YycF regulon, mainly involved in cell wall metabolism and membrane protein synthesis [Howell et aI., 2003]. Among these, YycF was shown to bind directly to the region upstream from the ykvT gene, encoding a potential cell wall hydrolase, and the intergenic region of the tagABltagDEF divergon, encoding essential components of teichoic acid biosynthesis. However, its detailed molecular mechanism has not been revealed yet. In this study, we focused on molecular mechanism of YycG-YycF system in B. subtilis (CHAPTER II). In addition, we characterized YycF (H21SP) mutation with Escherichia coli two-hybrid and homodimerization assays to investigate the molecular mechanism of the YycG-YycF two-component system. The discovery of a broad spectrum, selective inhibitor of TCSs would compromise the bacterium's ability to adapt and survive in any environment, thus making this an attractive antibacterial strategy. As yet, no promising inhibitors of TCSs have been identified, but the future success of this area depends on the design of. 4.

(11) physiologically-relavant, high-throughput assays for essential systems. Genomics has clearly highlighted TCSs as a valid approach for novel antibiotic discovery. Recently, we had demonstrated that imidazole compounds such as shown in Table 2 inhibited the autophosphorylation of YycG and were antibacterial agents against some drug resistant bacteria [Yamamoto et aI., 2000, 2001]. Furthermore, one of them, I-benzyl-3-cetyl-2-methylimidazolium iodide (NHI25) also inhibited eukaryotic elongation factor 2 (eEF-2) kinase against human cancer cell lines [Arora et aI., 2003]. NH125 inhibited eEF-2 kinase activity (ICso=60 nM) in vitro, blocked the phosphorylation of eEF-2 in intact cell, and showed relative selectivity over protein kinase: protein kinase C (IC so=7.5 J.1M, protein kinase A (IC so=80 J.1M), and calmodulin-dependent kinase II (IC so>100 J.1M). Thus, histidine kinase inhibitors are potential to be anticancer drugs as well as antibacterial agents. In this study, we have developed a screening method for antibacterial agents that inhibit that the essential HK, YycG (CHAPTER III). In addition, we have characterized an inhibitor (aranorosinol B) that shows antibacterial activity against B. subtilis and S. aureus and inhibits autophosphorylation of YycG. Table 2. Imidazole derivatives.. R. l-alkyl*2-mcthylimidazolium iodide. l-alkyl-3-butyl-2-mcthylimidazolium iodide. 3-alkyl-l-benzyl-2-mcthylimidazolium iodide. C.H9. NH1l9. C.H 17. NH1l8. NH123. NH128. C 12H2!i. NH1l7. NH122. NH127. C 1.H 29. NHl16. NH121. NH126. C 16H". NHllS. NH120. NH12S. NH129. 5.

(12) CHAPTER II. Molecular characterization of the essential two-component system, YycG-YycF in Bacillus subtilis. Introduction. Essential genes encoding the two-component system (TCS) for cell growth have been identified in various gram-positive bacteria [Fabret and Hoch, 1998; Lange et al., 1999; Martin et al., 1999]. Bacillus subtilis contains 36 histidine kinases and 34 response regulators [Fabret et al., 1999; Kunst et al., 1997], but there is only one essential TCS: YycG-YycF. In addition, a temperature-sensitive (ts) YycF response regulator (RR) mutant has been isolated and shown to have an H215P mutation in a putative DNA-binding domain which is closely related to that of the OmpR family of RRs [Fabret and Hoch, 1998] (Fig. 1). At the nonpermissive temperature, the ts mutant. ~l. ~2. ~3. f34. ~5. al. •. -t...--1-t...---1_t...-----C:::~. 122. -. 1-I 37. OmpR RRQANELPGA PSQEEAVIAF GKFKLNLGTR EMFREDEPMP LTSGEFAVLK ALVSHPREPL. ***. *. *. *. **. **. ** .. *.. *. *. YycF RRQLTTAPAE EEPSSNEIHI GSLVIFPDAY VVSKRDETIE LTHREFELLH YLAKHIGQVM 118. 133. a2. a3. _","'~r'''v''A - - -... -=::c:,;~~:,>~,,--. 182. '. ,,'-;. ~6. ~7. __IIIt~_t~... OmpR SRDKLMNLAR GREYSAMERS IDVQISRLRR MVEEDPAHPR YIQTVWGLGY VFVPDGSKA. . * .. *.. .. *. *. *. **. ***. .. * .. *.**. * *. * **. YycF TREHLLQTVW GYDYFGDVRT VDVTVRRLRE KIEDNPSHPN WIVTRRGVGY YLRNPEQD. 215. 178. Fig. 1. Alignment of C-terminal resion of OmpR and YycF. The numbers above the sequence indicate. positions from N-terminal amino acid. The tubes indicate a-helixes and the arrows indicate. 6. ~-sheets..

(13) stopped growing within 30 min. The effects of this point mutation are strongly bactericidal at the nonpermissive temperature [Fabret and Hoch, 1998]. Furthermore, production of mini-cells and reduction in cell length occurred when YycF was overproduced in B. subtilis. These observations led to the discovery that YycF overproduction up-regulates the expression from the PI promoter of the cell division operon, jtsAZ. In addition, YycF was found to bind to the PI promoter region in vitro [Fukuchi et aI., 2000]. These results indicated that the essential TCS, YycG-YycF, has the potential to modulate expression of thejtsAZ operon in B. subtilis. Recently Howell et aI. found that YycF directly binds to the regulator regions ofjtsAZ as well as to that of yocH, which encodes as autolysin. Nucleotide sequence analysis and site-directed mutagenesis revealed a potential consensus recognition sequence (YycF box) for the YycF, composed of two direct repeats: S'-TGT Aff A Aff/C-NS-TGT Aff A Aff/C-3'. A DNA-motif analysis indicates that there are potentially upto 10 genes within the B. subtilis YycG-YycF regulon, mainly involved in cell wall metabolism and membrane protein synthesis [Howell et aI., 2003]. In this study, we characterized YycF (H21SP) mutation with Escherichia coli. two-hybrid and homodimerization assays to investigate the molecular mechanism of the YycG-YycF two-component system.. Materials and Methods. Bacterial strains, plasmids, and culture conditions Bacterial strains and plasmids used in this study are listed in Table 1. These strains were cultured in Luria-Bertani (LB). DHPI and JM109 were used for the E. coli. 7.

(14) two-hybrid assay and the homodimerization assay, respectively. When necessary, selective antibiotics were added to LB as follows: 100 chloramphenicol, 12.5. ~g/ml. ~g/ml. ampicillin, 25. ~g/ml. tetracycline.. Table 1. Strains and plasm ids. Strain or plasmid Strains E. coli XL-l blue DHPI JMI09 M15 (pREP4) B. subtilis 168 Plasmids pBY33 pYycG pYycG (H386A) pYycF pYycF (H215P) pT25 pT18 pT25BsGtru pT18BsGtru pT25BsF pT18BsF pT25BsF (H215P) pT18BsF (H215P) pKWY2428. Relevant genotype. recAl, endAl, gyrA96, thi-l, hsdR17, supE44, relAl, lac [F', proAB, lacIqZ1. M15, Tnl0, (Tet')] F·, glnV44(AS), recAl, endAl, gyrA96 (Nai'), thi-l, hsdR17, spoTl, rjb])l, cya recAl, endAl, gyrA96, thi, hsdR17, supE44, relAl, 1. (lac-proAB), F' [traD36,proAB+, lacIq, lacZ1.M15] thi, lac, mtl, F·, Km'. Reference or source. Laboratory stock D. Ladant Laboratory stock QIAGEN H. Yoshikawa. trpC2. pBluescript II SK+ containing yycFG from B. subtilis, Ap' pQE30, C-terminal region (204 aa to 611 aa) of YycG, Apr pYycG, YycG (H386A) pQE30, YycF, Apr pYycF, YycF (H215P) pACYC184, N-terminal region (1 aa to 224 aa) ofCyaA, Cm' pBluescript II KS, C-terminal region (225 aa to 399 aa) ofCyaA, Ap' pT25, C-terminal region of YycG pT18, C-terminal region of YycG pT25, YycF pT18, YycF pT25BsF, YycF (H215P) pT18BsF, YycF (H215P) homodimer detection vector containing N-terminal region (1 aa to 131 aa) of leI repressor, Cm' pUN122 plasmid vector containing leI repressor, Apr, Tc' pKWY -leI pKWY2428, C-terminal region (132 aa to 216 aa) of lcI repressor pKWY-YycF(12OC) pKWY2428, C-terminal region (120 aa to 235 aa) of YycF pKWY-YycF(12OC, H215P) pKWY-YycF(l2OC), YycF (H215P). K. K. K. K.. Yamamoto et al. Yamamoto et al. Yamamoto et al. Yamamoto et al. This study G. Karimova et al. G. Karimova et al. This study This study This study This study This study This study R. Novy B. Nilsson et al. This study This study This study. Construction of plasmids. Plasmids pT25BsGtru, pTl8BsGtru, pT25BsF and pT18BsF were constructed for the E. coli two-hybrid assay. To obtain pT25BsGtru and pTl8BsGtru, a fragment encoding. the cytoplasmic domain (204 aa to 611 aa) of YycG was amplified by peR using. 8.

(15) pBY33 as the template, THGBSTRU-F and THYYCG-R as primers (Table 2) and Ex Taq DNA polymerase (TaKaRa). This fragment was digested with Sfi I, and ligated into. the Sfi I site of pT25 or pT18. A fragment encoding YycF was amplified by PCR using pBY33 as the template, THYYCF-F and THYYCF-R as primers (Table 2). This fragment was digested with Sfi I, and ligated into the Sfi I site of pT25 or pT18 to obtain pT25BsF and pT18BsF. Subsequently, pKWY-AcI and pKWY-YycF (120C) were prepared for a homodimerization assay. A fragment encoding the C-terminal domain (132 aa to 216 aa) of the Ad repressor was amplified by PCR using pUN122 [Nilsson et al., 1983] as the template and CIBGL2-F and CIKPN1-R as primers (Table 2), and was digested with Bgl II and Kpn I. This fagment was cloned into the Bgl II and Kpn I site of pKWY2428 to construct pKWY-AcI. To obtain pKWY-YycF (120C), the fragment was amplified by PCR using YYCFBGL2-2F and YYCFKPN1-2R as primers (Table 2) and pBY33 as the template. This Bgl II and Kpn I fragment encoding YycF (120C) was inserted into the Bgl II and Kpn I site of pKWY2428.. Table 2. Primers. Primer. Sequence. YMIF. GACAACCCGAGCCCTCCAAATTGGATCGTC. YMIR. GACGATCCAATTTGGAGGGCTCGGGTTGTC. ITSA2F. ATATTCGCATTTGGAGTCAG. ITSA2R. GTTGTTCATTCTATGGCACC. THGBSTRU-F. CTTCTCGGGGCCCTGAGGGCCAGAACCATT. THYYCG-R. GTGGCCGCATAGGCCCGCTTCATCCCAATC. THYYCF-F. AAGGCCCTGAGGGCCGATAAAAAGATCCTT. THYYCF-R. TTGGCCGCATAGGCCGTCCTGTTCTGGGTT. CIBGL2-F. GGAAGATCTTAGCACAACCAAAAAAGCCAG. CIKPNI-R. CGGGGTACCCCGTTAGCCAAACGTCTCTTC. YYCFBGL2-2F. GGAAGATCTTCCACAGCTGACAACAGCGCC. YYCFKPNI-2R. CGGGGTACCCCGTTAGTCCTGTTCTGGGTT. 9.

(16) Site-directed mutagenesis. The H215P mutation of YycF was generated by the QuikChange™ Site-Directed Mutagenesis Kit, Stratagene using pYycF, pT25BsF, pT18BsF, and pKWY-YycF (l20C) as the template and YM1F and YM1R as primers (Table 2) to obtain pYycF (H215P), pT25BsF (H215P), pT18BsF (H215P), and pKWY-YycF (l20C, H215P), respectively. These constructs were confirmed by automated dideoxy DNA sequencing.. Purification ofYycG, YycF (H215P), YycG, and YycG (H386A). To purify YycF, YycF (H215P), YycG, and YycG (H386A) for His6-tag proteins as described in [Yamamoto et al., 2001], M15 (pREP4) containing pYycF, pYycF (H215P), pYycG, and pYycG (H386A) were used, respectively.. Circular dichroism (CD). The far-ultraviolet CD spectra of YycF and YycF (H215P) were obtained in a 50 mM sodium phosphate buffer (pH 7.0) using a Jasco J-720 spectropolarimeter (cell length, 0.1 cm). To obtain the thermal unfolding curves, the CD value at 222 nm was monitored while the solution temperature was raised at a rate of 1°C/min. It was possible to measure the solution temperature directly measured by placing a thermocouple (model DP-500, Rikagaku Kogyo) into the cell. The fraction of unfolding protein was calculated from the CD values by linearly extrapolating the pre- and post-transition baselines into the transition zone, and was plotted against temperature.. In vitro autophosphorylation and phosphotransfer. In autophosphorylation, 5 pmol of YycG was autophosphorylated with [y_32 p ]ATP. 10.

(17) (37 kBq) for 10 min at 25°C in 10 J.11 of reaction buffer A (50 mM Tris-HCI [pH 7.5], 50 mM KCI, 50 mM MgCh) containing 2.5. J.1M. ATP. To stop the reaction, 2 X Sample. buffer (120 mM Tris-HCI [pH 6.8], 20% glycerol, 4% SDS, 10% p-mercaptoethanol, 0.1 % BPB) was added. In phosphotransfer reaction, 40 pmol of YycF in buffer A containing 1.2. J.1M. ATP was added and incubated for 10 min at 25°C after. autophosphorylation of YycG. In phosphotransfer from autophosphorylated YycG (YycG-P) to YycF and YycF (H215P), we preincubated 40 pmol of YycF and YycF (H215P) for 30 min at 25, 37, and 47°C in 2 J.11 of reaction buffer A containing 1.2. J.1M. ATP. After 5 pmol of YycG was autophosphorylated, preincubated YycF or YycF (H215P) was added before the incubation for 10 min at 25°C.. Preparation of the probe for gel mobility-shift assay and DNase I footprinting. The primer FTSA2R was labeled with. [y_32 p ]ATP. (370 kBq) and T4 polynucleotide. kinase (TOYOBO). The labeled probe for gel mobility-shift assay and DNase I footprinting was prepared as followed: PCR amplification was performed with Ex Taq DNA polymerase; genomic DNA of B. subtilis; the labeled FTSA2R and FTSA2F for the probe as primer pairs. The PCR product labeled with 32 p was then recovered from a polyacrylamide gel. The labeled probe encompassed -250 to +36 oftheftsAZpromoter.. Gel mobility-shift assay. The probe (20,000 cpm, 4 fmol) was incubated with YycF or YycF (H215P) for 10 min at 37°C in 12.5 J.11 of binding buffer (10 mM Tris-HCI [pH 7.4], 3 mM MgCh, 5 mM CaCh, 1 mM EDTA, 50 mM KCI, 5% glycerol, 0.05% Nodiet P-40). After adding a. DNA dye solution (40% glycerol, 0.025% bromophenol, 0.025% xylene cyanol), the. 11.

(18) mixtures were directly subjected to 6% polyacrylamide gel electrophoresis (pH 6.0).. DNase I jootprinting assay. The probe (40,000 cpm, 8 fmol) was incubated with YycF or YycF (H215P) for 10 min at 37°C in 25 JlI of binding buffer (10 mM Tris-HCI [pH 7.4],3 mM MgCh, 5 mM CaCh, 1 mM EDTA, 50 mM KCI, 5% glycerol, 0.05% Nodiet P-40), after which the temperature was reduced to 25°C. After incubation for 5 min, 12.5 ng of DNase I (Takara) was added and then digested for 30 sec at 25°C. The reaction was terminated by the adding 25 JlI of phenol/chloroform. Digested products were precipitated by ethanol, dissolved in a formamide dye solution, and analyzed by electrophoresis on a 6% polyacrylamide gel containing 8 M urea.. Escherichia coli two-hybrid assay. To investigate the protein-protein interaction of YycG-YycF signal transduction, we used the E. coli two-hybrid assay [Karimova et aI., 1998]: This system exploits the fact that the catalytic domain of the adenyl ate cyclase from Bordetella pertussis consists of two complementary fragments that are fused to interacting polypeptides, X and Y. Dimerization of these hybrid proteins results in functional complementation between T18 and T25 fragments and synthesis of cyclic AMP (cAMP) which turns on the expression of several genes, including genes involved in lactose and maltose catabolism. In the presence of cAMP, the bacteria therefore become able to utilize lactose or maltose. as the unique carbon source and can be easily distinguished by an indicator or a selective media. pT18, pT25, and E. coli cya mutant (DHPl) were used for the E. coli two-hybrid. 12.

(19) assay (Table1). Quantification of the functional complementation mediated by interaction between two proteins was performed by measuring f3-galactosidase activities as described in [Miller, 1972].. Homodimerization assay. To determine the homodimerization domain of YycF, we used the optimal temperature, 37°C for the homodimerization assay as previously described [Park et aI., 2000]: For this assay, we employed pKWY2428, developed by R. Novy [personal communication]. In pKWY2428, the N-terminal region (1 aa to 131 aa) of AcI by itself is unable to interact with another N-terminal region of AcI, and cannot repress the expression of the TcT gene, thus the strain becomes Tc resistant. When the N-terminal region of AcI is fused to a dimerizing domain, Z, the TcT gene expression is repressed and the strain becomes Tc-sensitive.. Cross-linking assays. Aliquots of 4 /lM YycG, YycF, or YycF (H215P) were incubated in 100 /ll HMKG buffer (50 mM HEPES [pH 7.5], 10 mM MgCh, 50 mM KCI, 20% glycerol) containing 300 /lM imidazole for 30 min on ice, and then 0.313 mM disuccinimidyl suberate (DSS). was added. After 2 h of incubation at 25°C, the reactions were stopped by the addition of 0.25 M glycine and 10% trichloroacetic acid (TCA) precipitation [Martin-Nieto and Villalobo, 1998]. The proteins were run on SDS-polyacrylamide gels. The gels were transferred to polyvinylidene difluoride membranes (PVDF; 0.45 /lM, MILLIPORE). The PVDF membranes were blocked with PBS buffer (137 mM NaCI, 8.1 mM Na2HP04, 2.68 mM KCI, 1.47 mM KH 2P04) containing 3% BSA and washed with PBS. 13.

(20) buffer containing 0.5% Tween, and incubated mouse anti-RGS (H)4 or mouse anti-(H)4 for YycG and YycF, respectively. The membranes were washed with PBS buffer containing 0.5% Tween, and bound antibodies were visualized with a goat anti-mouse IgG (H+L) alkaline phosphatase conjugated detection system (BIO-RAD).. Results. Autophosphorylation of YycG. and phosphotransfer reaction from YycG to YycF. YycG, YycG (H386A), YycF, and YycF (H215P) were purified as described in Materials and Methods (Fig. 2a). YycG or YycG (H386A) was incubated with [y_32 p ]ATP at 25°C, and then applied on SDS-polyacrylamide gel and analyzed. YycG. was autophosphorylated at 10 min after addition of [y_32 p ]ATP in vitro, but YycG (H386A) was not (Fig. 2b). In addition, YycG-P was able to transfer the phosphate group to YycF when combined with YycF (Fig. 2c). These results indicated that YycG is a histidine kinase and possessing the autophosphorylation activity and YycG-YycF constitute two-component system and show the high specificity of the histidine kinase and response regulator for the cognate phosphorylation partner.. 14.

(21) (a) 123. (b). (c) 1. 4. 2. 123. ,. 49kDa - -. .. 28kDa - - ...... ~. YycG. ....- YycF. Fig. 2. Autophosphorylation of YycG. and. phosphotransfer from. YycG to YycF.. (a). SDS-polyacrylamide gel electrophoresis of YycF (lane 1), YycF (H215P) (lane 2), YycG (lane 3), and YycG (H386A) (lane 4) (b) Autophosphorylation of YycG and yycG (H386A). Autophosphorylation was performed as described in Materials and Methods: lane 1, YycG; lane 2, YycG (H386A). (c) Phosphotransfer from YycG-P to YycF. Phosphotransfer reaction was performed as described in Materials and Methods : lane 1, YycG only; lane 2, YycF only; lane 3, YycG+YycF.. Effects oj YycF (H215P) mutation on the secondary structure and phosphotransJer. The C-terrninal domain of YycF response regulator has been assigned to the OmpR subfamily [Fabret and Hoch, 1998]. Examination of the crystal structure of the E. coli OmpR C-terrninal domain revealed that members of this subfamily belong to the winged helix-turn-helix family of DNA-binding protein [Martinez-Hackert and Stock, 1997], The therrnosensitive mutation (H215P) of YycF was localized to the loop connecting the 0:3 helix to the. ~6. and. ~7. C-terminal strands [Fabret and Hoch, 1998].. Fabret and Hoch suggested that substitution of a proline for a histidine at this site may perturb the DNA-binding properties of this region by destabilizing the interaction of. 15. ~6.

(22) and. ~7. with the rest of the molecule at elevated temperature. In this study, YycF and its. mutant YycF (H215P) were analyzed using CD spectroscopy to clarify the effect of YycF (H215P) mutation on its secondary structure. As shown in Fig. 3(a), the negative ellipticity was found to be suppressed by the mutation of His 215. The secondary structure of YycF (H215P) was significantly affected as compared with that of YycF at 20°C. When the solution temperature increased, the negative ellipticity of both proteins. (a) ~12~--------------------------~. ~1O. i bO. ~ 0. """""""""""""""""""""""""""""""""""""""-""""""'.:".::"":;;;;"""0:.>""~""---;. ';'. ~. x CD. ~-1O _11L---L-~-=~~--~--~~~~~. 190. 200. 220. 240. 260. Wavelength (nm). (b) 1.2 "0. -8. ;a. 0.8. §. 0.6. c::. 0.4. 0. •.;:l <.l. f. 0.2. "'"'. 0 "0.2 20. 30. 40 50 Temperature (OC). 60. 70. Fig. 3. CD spectroscopic analysis of YycF and YycF (H215P). (a) CD spectra of YycF (solid line) and YycF (H215P) (broken line) were obtained at 20DC from 190 to 260 nm. (b) CD values of YycF (closed circles) and YycF (H215P) (open circles) were recorded at 222 nm and normalized to the fraction unfolded, as described in the text. YycF and YycF (H215P) were used at a concentration of 10 f.lM.. was changed due to their thermal unfolding. The unfolding curves obtained by monitoring the CD value at 222 nm are shown in Fig. 3(b), where Tm values of YycF. 16.

(23) and YycF (H2I5P) were calculated to be 56.0°C and 45.9°C, respectively. These results suggest that the protein structure is significantly destabilized by the YycF (H2I5P) mutation with an increase in temperature. In addition, we examined phosphotransfer from YycG-P to YycF or YycF (H2I5P),. finding that phosphate was transferred from YycG-P to both YycF and YycF (H2I5P) at 25, 37, and 47°C, respectively (Fig. 4). Even though H2I5P mutation affected the secondary structure with an increase in temperature, the receiver domain located at the N-teminal portion remained active for phosphotransfer.. 2. 3. 5. 4. 6. Fig. 4. Phosphotransfer from YycG-P to YycF and YycF (H215P). After YycF (lanes I , 3, 5) and YycF (H215P) (lanes 2, 4, 6) were preincubated at 25°C (lanes 1,2), 37°C (lanes 3,4) and 47°C (lanes 5, 6), phospho transfer was performed as described in the text.. DNA-binding ability of YycF (H215P) In this study, we conducted gel mobility-shift assays to investigate the effect of. YycF (H2I5P) mutation on binding to the PI promoter region offtsAZ containing YycF box, finding that YycF (1.88 pmol) formed one major proteinlDNA complex with the labeled probe, but YycF (H2I5P) did not (Fig. 5). Furthermore, we performed DNase I footprinting to clarify the binding ability of YycF to the YycF box. Although YycF (3.75 pmol) protected the DNA region containing YycF box (Figs. 6a and 6b, lane 6), no protection region was observed when YycF (H2I5P) was used (Fig. 6b). Thus, the. 17.

(24) replacement of histidine residue with proline. In. Y ycF resulted. In. a decrease of the. binding ability to the YycF box.. YycF (H215P). YycF. S 1 2. 3. 4. 5 6. 7 8. s. 9 10 11 12. Fig. 5. Gel mobility-shift assay. The probe (286 bp) described in the text was incubated in the absence (lanes 1,7) or the presence of YycF (lanes 8-12) and YycF (H215P) (lanes 2-6) (lanes 2 and 8, 1.88 pmol ; lanes 3 and 9, 3.75 pmol; lanes 4 and 10, 7.50 pmol ; lanes 5 and lI , 15.0 pmol ; lanes 6 and 12,30.0 pmol) for 10 min at 37°C in binding buffer.. 18.

(25) (b). (a). YycF. •. gggagtcca tcttggtgtagacttgtatttagcaggtatattcgc atttggagtcagattatttcagaatatagccgttatcagaagaaa. YycF (H215P). •. 1 2 3 4 5 6 7 8 9 10. tcta ctaac a aagtggactctttctaaaaaa a ataaaaaaaatgt gata taaaagaggatatacataggatataacgaatattttcaata - 100. -90. -80. - 100. -70. aacataaaatgtgaaaagcacataaaaatattctgttgttatttt. ~. -~. -40. -30. -90. -20. tTGTTACacactTGTAAAgccacattca § tgta ~ tgttgttccgc. -80. PI , + 1 ~. -10. aaataa§ agaa ~agaaatgatcga a atgtg a ggaggtg ccataga. -70. atga a caacaatgaactttacgtcagtcttga cctcggtacgtcc. -60. MNNN. EL. YVS. LDLG. TS. -50 -40. I. -30. -20. -10. Fig_ 6_ DNase I footpri nting analysis_ (a) PI promoter of ftsAZ operon, The numbers above the sequence indicate positions relative to the transcriptional start point (+ I), and -10 and -35 sequences of the PI promoter are enclosed in boxes_ The direct repeats (TGT Aff A Aff/C-N5 -TGT AIT A AITIC) (YycF box)[Howell et aI., 2003] are indicated by arrows, (b) DNase I footprinting analysis of YycF and YycF (H215P) on the PI promoter of ftsAZ DNase I footprinting anaJysis was performed with YycF (lanes 3-6) or YycF (H215P) (lanes 7-10): lane I, A+G Maxam and Gilbert reaction ; lane 2, 0 pmol; lanes. 3 and 7,0.47 pmol; lanes 4 and 8, 0,94 pmol; lanes 5 and 9,1.88 pmol; lanes 6 and 10,3 _75 pmol.. 19.

(26) Effect of YycF (H215P) mutation on YycF- YycF homodimerization To study the effect of YycF (H215 P) mutation on YycF-YycF homodimerization, we used the optimal temperature, 30°C for an Escherichia coli two-hybrid assay as described previously [Karimova et al., 1998] (Figs. 7a, and 8a).. rn. (a). ~-~ AT~. N no cAMP. c. cAMP + CAP ~. ON. ~~~}--1111111111111111111~. C. " cAMP. cAMP/CAP dependent promoter. lacZ. (b) pKWY2428. ®® 1.351 1.loCi r;~ol LacrTc'. U>a.. Fig. 7. Principles of E co/itwo-hybrid assay and homodimerization assay. (a) E. coli two-hybrid assay. The two fragments, T25 and TI8 , when coexpressed as independent polypeptides in E. coli DHPI containing both pT25 and pT18, are unable to interact and no cAMP synthesis occurs (left). The two fragments , fused to two interacting proteins, X and Y, are brought into proximity, resulting in functionally complementing T25 and T I 8 pairs, and cAMP synthesis occurs (right). (b) Homodimerization assay. N: N-terminal region of AcI; Z: C-terminal portion (132 aa to 216 aa) of AcI derived from pUN122.. 20.

(27) (a) Two-hybrid assay pT25BsGtru. YycGtru. pTI8BsGtru 386. pT25BsF. pTI8BsF. ~35 -j_. ,---,(......... 0 ),...---r-I S3. pT25BsF (H2 15P). pTI8BsF (H2 15P). YycF. linker. =_. ==(:0)==1 S3. ~3S YycF (H215P). linker. (b) Homodimerization assay pKWY·YycF ( 12OC). YycF ( 12OC). pKWY·YycF ( 12OC, H215P). YycF ( 12OC, H215P). Fig. B- Schematic representation of the different YycG and YycF domains used for E coli two-hybrid and homodimerization assays. Numbers indicate the amino acid boundaries of the YycG and YycF polypeptides. YycGtru, cytoplasmic domain (204 aa to 611 aa); YycF, full-length protein (1 aa to 235 aa); YycF (H215P), YycF containing H215P mutation; YycF (120C), region (120 aa to 235 aa) containing DNA-binding domain (133 aa to 235 aa) [Fabret and Hoch, 1998]; and YycF (120C, H215P), YycF (120C) containing H215P mutation. H and D enclosed by a circle indicate phosphorylation sites of YycG and YycF, respectively.. Interactions between YycF proteins (Fig. 9, lane 7) or truncated YycG proteins (204 aa to 611 aa) (Fig. 9, lane 4) indicated that those proteins were stable and capable of association in E. coli. Furthermore, we investigated the effect of H215P mutation in YycF on YycG-YycF interaction. Consequently, both interactions of YycG-YycF and YycG-YycF (H215P) were observed (Fig. 9, lanes 11, and 12). Thus, YycF (H215P) mutation did not affect YycG-YycF interaction, which is consistent with the result obtained in Fig. 4. On the other hand, YycF (H215P) did not interact with itself (Fig. 9,. 21.

(28) lane 10); therefore, the YycF (H215P) mutation prevented the interaction between YycF and YycF, but not between YycG and YycF (Fig. 9, lanes 7, 10, 11, and 12). To confirm these data, we performed cross-linking assays for YycG, YycF, or YycF (H215P). As a result, chemical cross-linking was observed between YycG cytoplasmic domains, and between YycF proteins, but not between YycF (H215P) proteins (Fig. 10).. ~ '§ 1200. i. ?;o. '>. 1000 800. .. ~. ~. ... ~. Ol. 476.4. 552.2. "B 600 ., 400 200. til). c6.. 0 2 00. i=. .;. .e-. 0. N. 00. V'). I-. 0.. '" o:l. I-. .eV'). N. I-. c... 6. 4. ~ I-. c... ~. <II. o:l. V'). ~c... .;. u... 00. u... 0. 00. eO. i=c... 00. 00. eO. I-. c... i=c... I-. V;. '" o:l. ~0.. N. ]. i:t::. eO i:t::. V'). '". o:l. I-. c... V'). ~c... 0. '". ~ ~c... CC' ~. g u... 9. 10. 11. ~ I-. CC'. .;. .;. ~. g. 0. 0. eO. '" o:l. ~. u... i=0.. i=0.. ~. o:l. '". g. i=. u... 00. .e-. '" o:l. V'). V'). N. N. I-. 0.. I-. 0.. ~. '" o:l. 00. i=. ~ ~. ~. 00. i:t:: '" o:l V'). N. I-. c... 12. 00. ~ ~. g u... g. '" o:l. u... I-. eO. V'). N. 0.. V'). N. I-. 0.. Fig. 9. Analysis of protein-protein interaction on YycG-YycF two-component system using the. E coli two-hybrid assay. Each bar represents the mean from at least three independent transformants, each measured in duplicate. The numbers above the bars indicate the average of the case.. 22.

(29) 1. 2. 3. 4. 5. 6. -. --. Fig. 10. Cross-linking assays. Chemical cross-lintdng of YycG (lane I and 2), YycF (lane 3 and 4), and YycF (H215P) (lane 5 and 6) were performed in the absence (lane 1, 3, and 5) or the presence (lane 2, 4, and 6) of DSS and detected as described in Materials and Methods. The arrows indicated the positions of chemical cross-linked YycG and YycF.. To identify the homodimerization domain of YycF, we investigated the C-terminal domain, YycF (120C) (Fig. 8b) corresponding to the DNA-binding region (120 aa to 235 aa), using a homodimerization assay (Fig. 7b). In pKWY-AcIlJMI09 and pKWY-YycF (120C)/JMI09, the Tc f gene was repressed by Ad and Ad-YycF (120C) hybrid repressor, but not in pKWY2428/JMI09, pKWY-YycF (120C, H215P)/JMI09 became resistant to tetracycline (Fig. 11). These results suggest that the C-terminal portion (120 aa to 235 aa) containjng the DNA-binding domain of YycF is important for its homodimerization and replacement of the histidine residue (H215) with proline in YycF inhibits a homodimerization of YycF.. 23.

(30) 2 pKWY2428. pKWY-1cl. pKWY -YycF(120C). 4. 3 _. •. _. _~. ). ..... ~,. .. .. ...,.._. -.J. 5 .,. . ,'_ , .. 6 .... e. ... ...... } ... ... '. .. -..: . -""~. .. ..-. pKWY-YycF(120C, H215P). Fig. 11. Homodimerization assay. Overnight cultures of JM1 09 containjng pKWY2428 , pKWY -Acl, pKWY-YycF (120C) or pKWY-YycF (120C, H215P) were inoculated on LB agar (25 Ilg/ml chloramphenicol and 20 Ilg/ml tetracycline) at the following cell numbers: 3 X 106 cells (lane I), 3 X 10 5 cells (lane 2), 3 X 10 4 cells (lane 3), 3 X 10 3 cells (lane 4), 3 X 102 cells (lane 5), and 30 cells (lane 6), respectively, and were incubated at 37°C overnight. Discussion. The two-component system YycG-YycF of B. subtilis was constructed in vitro. YycG showed the autophosphorylation activity, but not YycG (H386A). YycF was phosphorylated by YycG-P (Fig. 2). These results demonstrated that YycG has autophosphorylation activity at His 386, and YycG-YycF constitute two-component system. It was revealed with CD spectroscopy that the secondary structure of YycF was significantly affected by the H215P mutation (Fig. 3) at 20°C. This result suggested that. in vitro, the effects of H215P mutation of YycF should be expected above 20°C. Thus, we performed the gel mobility-shift and DNase I footprinting assays at 37°C to clarify the differences of YycF and YycF (H215P) for DNA-binding. As the result, we. 24.

(31) demonstrated that YycF (H215P) was defective in its binding ability to the PI promoter region of JtsAZ at 37°C (Figs. 5 and 6). However, an in vitro phosphorylation assay revealed that this mutation did not have any effect on the phosphotransfer reaction of YycF by autophosphorylated YycG at 25, 37, and 47°C (Fig. 4). On the other hand, in vivo, the two-hybrid assay also showed that this mutation did not affect the interaction of YycG-YycF as well as YycG-YycG or YycF-YycF, but only YycF (H215P) homodimerization was severely inhibited (Figs. 9 and 11). In addition, chemical cross-linking was observed between YycG cytoplasmic domains, and between YycF proteins, but not between YycF (H215P) proteins (Fig. 10). These results suggested that in vitro and in vivo, the H215P mutation of YycF affects the DNA-binding domain for homodimerization more than the receiver domain. The DNA-binding domain of the NtrC response regulator was also involved in its dimerization in the NtrB-NtrC two-component system of Klebsiella pneumoniae [Martinez-Argudo et al., 2001]. These results suggest that the C-terminal domain of response regulators is important in forming a dimer. In the EnvZ-OmpR two-component system of E. coli, domain A (223 aa to 289 aa) and domain B (290 aa to 450 aa) in the cytoplasmic region of EnvZ histidine kinase (EnvZc) are involved in its dimerization [Zhu and Inouye, 2002]. The cytoplasmic region (204 aa to 611 aa) of YycG is also involved in its dimerization (Fig. 9, lane 4) and contains the domain A and B conserved in EnvZc (data not shown). We suppose that the dimerization of YycG is related to the interaction between domain A and domain B, as domain B of EnvZc from one monomer interacts with both helix I of domain A from the other monomer and helix II of domain A from the same monomer [Yang and Inouye, 1991; Qin et aI., 2000].. 25.

(32) Recently Yamamoto et aI. first isolated and characterized the inhibitor (NHI25, I-benzyl-3-cetyl-2-methylimidazolium iodide) of YycG, which has antibacterial activity against gram-positive bacteria including vancomycin-resistant Enterococcus jaecalis (VRE) and oxacillin-resistant Staphylococcus aureus (ORSA) [Yamamoto et aI., 2000, 2001]. In this study, we have shown that YycF dimerization is essential for cell growth. These results demonstrate the potential of TCS inhibitors including Y ycF dimerization as well as YycG as leads for antibacterial therapy.. 26.

(33) CHAPTER III. Sensitive genetic screening method for inhibitors of the essential two-component system, YycG-YycF. Introduction. The rapid emergence of antibiotic resistance in pathogenic bacteria has underscored the need for an accelerated approach to the discovery of new antibacterial agents. Bacterial genomics, bioinformatics and gene manipulation studies have led to the discovery of novel protein targets for antibacterial agents [Moir et al., 1999]. For instance, the two-component regulatory systems (TeSs) of bacteria, which consist of two proteins, histidine kinases (HKs) and response regulators (RRs), have received increasing attention for their potential as novel antibacterial drug targets for the following reasons [Barrette and Hoch, 1998, Macielag and Goldschmidt, 2000, Matsushita and Janda, 2002]. First, TeSs are essential for coordinated expression of stress-response genes including those for virulence factors. Second, some Tess regulate the expression of antibiotic resistance determinants including drug-efflux pumps [Hirakawa et aI., 2003, Kato et aI., 2000, Eguchi et aI., 2003]. Third, protein-histidine phosphorylation in the signal transduction pathway in bacteria is distinct from serine/threonine and tyrosine phosphorylation in higher eukaryotes. Finally, the high degree of structural homology in the catalytic domain of HKs and in the receiver domain of RRs suggests that multiple TeSs within a single bacterium could be inhibited simultaneously, potentially leading to a lower frequency of drug-resistant bacteria.. 27.

(34) Recently, a number of TCS autophosphorylation inhibitors with inhibitory activity against multi-drug resistant bacteria have been developed [Barrette and Hoch, 1998, Macielag and Goldschmidt, 2000, Matsushita and Janda, 2002, Barrette et al., 1998, Yamamoto et aI., 2000]. However, the mode of actions remains mostly unsolved, and bactericidal properties may be attributable to multiple mechanisms. In some cases, bacterial growth inhibition is independent of TCS inhibition [Barrette and Hoch, 1998, Macielag and Goldschmidt, 2000, Matsushita and Janda, 2002]. TCS is a fundamental system of bacterial response to environmental stresses in both gram-negative and gram-positive bacteria, but is not needed for steady-state growth without the stress. Thus, the genes for TCS are usually non-essential for cell growth. However, a small number of TCS-encoding genes are essential in both gram-negative and gram-positive bacteria [Beier and Frank, 2000, Fabret and Hoch, 1998, Langer et aI., 1999, Martin et al., 1999, Throup et al., 2000, Zahrt and Deretic, 2000]. In Bacillus subtilis, there are 36 HKs and 34 RRs [Kobayashi et aI., 2001], of which only one TCS,. YycG (HK)-YycF (RR), is essential [Fabret and Hoch, 1998, Kasahara et aI., 1997]. In fact, Fabret et al. isolated yycF temperature-sensitive (ts) strain (JMI7041) with A-to-C mutation at position 35103 (DNA Data-Bank accession no. D78193), which leads to histidine-to-proline (H215P) substitution [Fabret and Hoch, 1998]. Such an essential TCS gene could be useful for the screening of antibacterial agents against TCS. Homologues of the B. subtilis YycG-YycF pair have also been identified in Staphylococcus. aureus,. Streptococcus pneumoniae, Enterococcus jaecalis and. Streptococcus pyogenes [Fabret and Hoch, 1998, Lange et aI., 1999, Martin et aI., 1999,. Throup et aI., 2000]. In S. aureus, a yycF-ts mutant has been isolated, which carries a Glu-to-Lys point mutation at position 63 in the receiver domain of the YycF response. 28.

(35) regulator [Martin et aI., 1999]. Since this point mutation in yycF leads to severe defects in bacterial growth at non-permissive temperatures, the YycG-YycF system may be an excellent target of novel antibiotics [Martin et aI., 1999]. Based on these considerations, we have developed in this study a screening method for the inhibitors of the essential HK, YycG. Aranorosinol B from Gymnascella dankaliensis was identified as a result of this screen.. Materials and Methods. Strains and media B. subtilis 168 (trpC2) and its ts mutant CNM2000 (trpC2, yycF [H215P], Cmr), E. coli M15 [pREP4] (lac, ara, gal, mtl, F, lacI, Kmr) and BL21 (DE3) (F, dcm, ompT, hsdS [rB- mB-], gal, A[DE3]) were cultured in Luria-Bertani broth (LB). E. coli M15. [pREP4] was used for expressing YycF and YycG from B. subtilis. E. coli BL21 (DE3) was used for the expression of S. aureus YycF and YycG and E. coli HKs. When necessary, LB was supplemented with ampicillin, kanamycin, chloramphenicol, and neomycin at concentrations of 100, 25, 5 and 3 Jlg/ml, respectively.. Plasmids. The plasmids used in this study are listed in Table 1. To obtain YycF and the cytoplasmic domain (Arg204 to Gln6os) of YycG from S. aureus 209P [Martin et aI., 1999], a 0.7 kbp fragment containing yycF and a 1.2 kbp fragment containing yycG were. amplified. by. PCR. using. genomic. DNA. as. the. template,. SAFF-2. (5'-GAAAAGAGGTTTGGATCCATGGCTAGAAAA-3') and SAFR-2 (5'-CATTCG. 29.

(36) TTTCGCGGCCGCCTCATGTTGTTG-3') for yycF and SAGF-2 (5'-AGGATT CTTTGGATCCCGAACGATTACCAA-3') and SAGR-2 (5'- TTTAATATGCTGCGG CCGCTTCATCCCAAT-3') foryycG as primers and Ex Taq DNA polymerase (Takara). These fragments were digested with BamHI and NotI, and ligated into pET-21a (+) between BamHI and NotI sites to obtain pYycFSa and pYycGSa. To construct pHKs (Table 1), DNA fragments containing the cytoplasmic region of HKs were prepared by PCR using genomic DNA (E. coli W3110) as the template and a pair of primers in Table 2. The PCR-amplified fragments were inserted into pET21a (+) to generate pHKs (Table 1).. Construction of B. subtilis CNM2000. pBY33 containing B. subtilis yycFG [Yamamoto et aI., 2001] was digested with BsgI and then blunted with T4 DNA polymerase (Toyobo) (Fig. 1). A fragment Cmf cassette digested with SmaI from pBEST4C was ligated into the blunted site of pBY33 to construct pBYCl. In addition, a fragment Nm f cassette digested with XbaI from pBEST501 was ligated into the Spel site of pBYCl to make pBYCNl. The H215P mutation [Fabret and Hoch] of yycF was generated by PCR using QuikChange™ Site-directed Mutagenesis Kit (Stratagene), pBYCNl and the primers YMIF (5'-GACAACCCGAGCCCTCCAAATTGGATCGTC-3') and YMIR (5'-GACGAT CCAATTTGGAGGGCTCGGGTTGTC-3') to obtain pBYCNMl. After pBYCNMl digested with BamHI was transformed into B. subtilis 168, a ts strain (CNM2000), which did not grow at 47°C on an LB plate, was obtained as a chloramphenicolresistant and neomycin-sensitive strain (data not shown).. 30.

(37) Table 1. Plasmids. Characteristics. Plasmids. Reference or source. pBluescript II SK +. cloning vector, Ap'. Stratagene. pQE30. expression vector, Ap'. Qiagen. pET-21a (+). expression vector, Ap'. Novagen. pBEST4C. Ap',Cm'. M. Itaya. pBEST501. Ap',Nm'. M.ltaya. pBY33. pBluescript II SK+ containing yycFG (3,916 bp). Yamamoto et at.. pBYCNI. pBY33, Cm', Nm'. This study. pBYCNMI. pBYCNI,yycF (H215P). This study. pYycF'). BamH I - Pst I fragment (703 bp) encoding YycF of B. subtilis (2 to 235"; SWISS PROT P37478). Yamamoto et at.. pYycG'). BamH I-Pst I fragment (1,254 hp) encoding YycG of B. subtilis (204 to 611"; SWISS PROT Q456 14). Yamamoto et at.. pYycGSa"2. BamH I-Not I fragment (1,214 bp) encoding YycG of S. aureus (204 to 608"; TrEMBL Q9XCM6). This study. pYycFSa"2. BamH I-Not I fragment (701 bp) encoding YycF of S. aureus (I to 234"; TrEMBL Q9XCM7). This study. pHKs"2. This study. pKH41-l4. BamH I -NotI fragment (2,100 bp) encoding ArcB (79 to 778"; SWISS PROT P22763). pKH21-11. BamH I - Not I fragment (843 bp) encoding BaeS (187 to 467; SWISS PROT P30847). pKH37-3. BamH I -NotI fragment (2,166 bp) encoding BarA (197 to 918; SWISS PROT P26607). pBasS. Nde I - Not I fragment (825 bp) encoding BasS (89 to 363; SWISS PROT P30844). pKH17-2. BamH I - Not I fragment (1,962 bp) encoding CheA (I to 654; SWISS PROT P07363). pKH49-2. BamH I -NotI fragment (804 bp) encoding CpxA (190 to 457; SWISS PROT P08336). pKH54-11. BamH I - Not I fragment (810 bp) encoding CreC (205 to 474; SWISS PROT P08401). pCusS. BamH I - Not I fragment (819 bp) encoding CusS (208 to 480; SWISS PROT P77485). pKH52-4. BamH I - Not I fragment (1,023 bp) encoding DcuS (203 to 543; SWISS PROT P39272). pKH42-4. BamH I - Not I fragment (804 bp) encoding EnvZ (183 to 450; SWISS PROT P02933). pKH56-2. BamH I -NotI fragment (1917 bp) encoding EvgS (559 to 1,197; SWISS PROT P30855). pHydH. Nde I - Not I fragment (729 bp) encoding HydH (223 to 465; SWISS PROT PI4377). pPhoQ. Nde I - Not I fragment (810 bp) encoding PhoQ (217 to 486; SWISS PROT P23837). pKH2-2. BamH I - Not I fragment (1,140 bp) encoding PhoR (52 to 431; SWISS PROT P08400). pKHI4-4. BamH I - Not I fragment (831 bp) encoding RstB (157 to 433; SWISS PROT PI 8392). pKH8-1. BamH I - Not I fragment (1,683 bp) encoding TorS (354 to 914; SWISS PROT P39453). pKH45-3. BamH I - Not I fragment (681 bp) encoding UhpB (274 to 500; SWISS PROT P09835). pKH19-3. BamH I - Not I fragment (819 bp) encoding YedV (108 to 452; SWISS PROT P76339). pKH36-j. BamH I -NotI fragment (843 bp)encoding YfhK (216 to 496; SWISS PROT P52101). *1, all fragments were cloned into pQE30; *2, all fragments were cloned into pET-2la (+); *3, position number of amino acid residues from N -terminal of each protein. Ap', ampicillin resistance; Cm', chloramphenicol resistance; Nm', neomycin resistance.. 31.

(38) (a) pBYCNl. Sma I. Sma I. Cm'. Sma. ~. Ap'. 8. Xba J. lAp'. Xba I. YYCFG / Bsg I. .AP'C'. lAp'. /. yycFG. ~ ~ cm'. Digestion with Bsg I and Ii galion. Xba. 1f---1I.-. -1 .---. pBY33-. Nm'. yycFG Ap'. Digestion with Spe I and Ii ga li on. SpeJ. SpeJ. (b) H215P mutation in YycF. AP'E~ ~ pBYCNl. AP'E OY~~~6H215P). ---+.. ________. pBYCNMl. Site· directed mutagenesis C~. C~. N~. N~. Ap'. yycF(H2 15P) yycG Cm'. ~. Nm' =. , -----. Q. 1. X. ----. ~---. yycFG Transfonnation into B. subtilis 168. (e) CNM2000. E. A '. P. BamH J. o yycF(H215P) yycG pBYCNMl. Nm'. Ap'. yycF (H2 15P) )'ycG Cm'. ~. 0. Nm'. ._____. Digestion • ~ Cm'. Genomic. DNA. 1. Homologous. recombination. yycF (H215P) yycG Cm' --- 0 Genomic. wilh BamH I. CNM2000 (Cm' and Nm'). Fig. 1. Construction of CNM2000.. 32. DNA.

(39) Table 2. Primers for pHKs.. Primer. Sequence (5' ..... 3'). Plasmid (pHKs). ARCBF ARCBR BAESF BAESR BARAF BARAR BASSF BASSR CHEAF CHEAR CPXAF CPXAR CRECF CRECR CUSSF CUSSR DCUSF DCUSR ENVZF ENVZR EVGSF EVGSR HYDHF HYDHR PHOQF PHOQR PHORF PHORR RSTBF RSTBR TORSF TORSR UHPBF UHPBR YEDVF YEDVR YFHKF YFHKR. TTCTATCGGTGGTCGGATCCCAACTGGAGG GGTCTAGCGCGGCCGCTrMtTAGTGGCTT CACTTTTCTGGGATCCCGCGGTTTACTGGC ATTGGTAAGCGGCCGCTACTTCTCTCTGTA TGCGCTTATTTTTGGATCCCGCTTAATGCG ACTCGACAAGACGCGGCCGCCCCGAGAATT CTGCTATCAGCATATGCGCCGCATCACCCG GGTCAGCAGCGCGGCCGCTATCTGGTTTGC CCGAACCGAGGTGGATCCGTGAGCATGGAT GTTACCTTTTTAGCGGCCGCGGCGGCGGTG AGTCTGGCAAAAGGATCCCGTAAGCTGAAA GCAAATGCGCGGCCGCACTCCGCTTATACA TGGCGCAGGCATGGGATCCTGGATCAACCG TGTGGGAAGAATTGCGGCCGCTGTGAAGTG GCAACATGCGGAGGATCCATGAAACTGTTG CCGTTTGCTGGCGGCCGCAGCGGGTAATGT GGCACCTGCATTGGATCCAAGGTACTGAAA ATAACCAGCGGCGGCCGCTTGGCAATATTG GTTTATTCGTGGATCCAACCGACCGTTGGT CTTCGCCTCCCGGCGGCCGCCCCTTCTTTT TGGGGATTCTACGGATCCCGCTCAGTTCGT ATTGTGGGAGCCGCGGCCGCGTCATTTTTC GTCATTCTTCCATATGCGCCGCTATCTGCG CGATATTATCGCGGCCGCTCCTTGTGGGTC GGTCGCCGCCCATATGAGTTTACGCCCCAT GAAGTATGGGGCGGCCGCTTCATCTTTCGG ATTTCTGGAATGGATCCCGCCTTTCATGGT TAAAAGATGACAAAGGCGGCCGCATCGCTG TCCGGTGTTTGGATCCATGCGTCCGCACTG ATCGTGCGCGGCGGCCGCGGCAGAGGTAAA CTCTGGCGCGTGGGATCCCGCTCAGTCACG ACTGGCTGATAGCGGCCGCAATCGCGTTCA GTTGCTTGGCGCTGGATCCCAGCGGTTGCG GGCAACATCATCGCGGCCGCGACATAGCGT TTAAGTCCGGGATCCATCAGAACGGGATTA GCGTACTGAAGCCGCGGCCGCATTTCTTTG TGGTACTGCTTGGATCCCGGATGATTATCG AGGATAGGCTGTGCGGCCGCTTTCGTGTTT. pKH41-14 pKH41-14 pKH21-11 pKH21-11 pKH37-3 pKH37-3 pBasS pBasS pKH17-2 pKH17-2 pKH49-2 pKH49-2 pKH54-11 pKH54-11 pCusS pCusS pKH52-4 pKH52-4 pKH42-4 pKH42-4 pKH56-2 pKH56-2 pHydH pHydH pPhoQ pPhoQ pKH2-2 pKH2-2 pKHI4-4 pKHI4-4 pKH8-1 pKH8-1 pKH45-3 pKH45-3 pKH19-3 pKH19-3 pKH36-1 pKH36-1. Purification of YycF, YycG and HKs B. subtilis YycF and YycG, S. aureus YycF and YycG, and E. coli HKs were purified as His6-tag proteins as described previously [Yamamoto et aI., 2001].. 33.

(40) Bioassay. In order to search for HK inhibitors, the acetone extracts of 4000 microbes were spotted on Trypticase Soy (0.75%) agar (1.5%) plates that were overlaid with 3 ml of top-agar (0.5%) containing 30. ~l. of overnight culture of B. subtilis 168 or CNM2000.. After 24 h of incubation at 37°C, we selected the samples that inhibited growth of CNM2000 more strongly than that of 168.. Autophosphorylation oj HKs and phosphotransJer to RRs. Autophosphorylation of HKs and their phosphotransfer to RRs were performed as described in Materials and Methods in CHAPTER II.. MAP kinase assay. 0.5 U of p42 MAP kinase (New England Biolabs, Inc.) and 2. ~. of myelin basic. protein (MBP, Gibco BRL) were contained in a MAPK buffer (50 mM Tris-HCI [pH 7.5], 10 mM MgCh, 2 mM DTI, 1 mM EDTA, 0.01 % Brij 35). The phosphorylation of MBP was started by addition of 1 ~Ci of [y_32 p ]ATP diluted with unlabeled ATP to a final concentration of 2.5. ~.. 30°C before adding 10. ~l. glycerol, 4% SDS, 10%. The reaction mixture (10. ~l). was incubated for 10 min at. of 2 X sample buffer (120 mM Tris-HCI [pH 6.8], 20%. ~-mercaptoethanol,. 0.1 % BPB).. To assay the inhibitors, p42 MAP kinase and MBP were incubated for 5 min in the MAPK buffer containing the inhibitors and then [y_32 p ]ATP was added and reacted for 5 min.. 34.

(41) Determination of IC50. All the phosphorylated products were separated by using SDS-polyacrylamide gel electrophoresis and quantitated with a phosphoimager (Fuji Bas 1000 Mac). IC 50 was calculated from the intensity of bands of each phosphorylated product after subtraction of the background.. Isolation of aranorosinol B from Gymnascel/a dankaliensis. An antibacterial substance was extracted with acetone from the culture broth of G. dankaliensis grown for 4 days at 25°C in two liters of medium (6% modified starch, 1%. glucose, 6% com steep liquor, 1% cotton seed meal, I % soy bean powder, 1.6% KH 2P04, 1.2% Na2HP04) after being precultured for 4 days at 25°C in 60 ml of medium (2% com starch, 1% glycerol, 1% sucrose, I % cotton seed meal, 1% gluten meal, 0.2% Tween 80). The acetone extract was passed through a column (100 ml) of DIAION HP20 (Mitsubishi Chemical Co., Ltd.). The column was washed with 50% aqueous methanol (300 ml) and eluted with methanol (500 ml). The eluate was diluted with an equal volume of water and passed through a column (350 ml) of YMC-GEL (ODS-AMI20-S50, YMC Co., Ltd.). The column was eluted with 60% aqueous acetonitrile. The eluates were assayed for antibacterial activity and monitored by analytical HPLC. The active fractions containing antimicrobial substances were combined and diluted with an equal volume of water and passed through a column (350 ml) of YMC-GEL. The column was eluted with 55% aqueous acetonitrile. The active fractions were concentrated in vacuo to dryness and dissolved in a small amount of chloroform. nHexane was added to the solution and the mixture was allowed to stand at room temperature to obtain the precipitate of the active substance. The active substance. 35.

(42) was obtained as a white powder (110 mg). It was identified as aranorosinol B [Roy et al., 1992] using l3C NMR (Bruker DRX 500) and mass spectrometric (MS) analysis (Agilent 1100, LC-MS).. Docking analysis. The ATP-binding domain of EnvZ was downloaded from protein data bank (PDB, http://www.rcsb.org). The stereo-chemical structures (B-1 and B-2) of aranorosinol B were determined using ChemDraw -Chem3D and these files were converted to PDB files. The docking experiments of aranorosinol B against the ATP-binding domain of EnvZ were performed using Autodock v3.0.5. Five conformers of aranorosinol B-1 and B-2 that showed the stable docking energy were obtained.. Results and Discussion. Cross phosphotransJer from YycG to YycF between B. subtilis and S. aureus. To study the interspecies pair phosphotransfer reaction, we performed in vitro phosphotransfer reaction using YycG and YycF of B. subtilis and S. aureus. Observing phosphate transfer between proteins from the two different species would indicate that the two transfer interfaces are similar across the two species [Fisher et aI., 1995]. To determine in vitro noncognate interaction, YycG proteins were first allowed to autophosphorylate in the presence of [y_32 p ]ATP before mixing with their cognate and noncognate YycF. Phosphotransfer was observed between B. subtilis and S. aureus as shown in Fig. 2. Recently, Clausen et al. [2003] revealed that phosphotransfer from YycG to Y ycF was observed between the S. aureus and S. pneumoniae Y ycFG proteins.. 36.

(43) Thus, YycG-YycF system in gram-positive bacteria was highly conserved and inhibitors of YycG-YycF system were possible to have antibacterial activity against many gram-positive bacteria.. (a) 5. 10. 20. 30. 5. 10. 20. 30. (min). "'-YycG "'-YycF. (b) 5. 10. 20. 30. 5. 10. 20. 30. (min). ",-YycG ...-YycF. Fig. 2. Cross-talk between YycGs and YycFs from B. subtilis and S. aureus. (a) Phosphotransfer reaction was performed from YycG (B. subtilis, 5 pmol) to YycF (B. subtilis, left, 40 pmol) or YycF (S. aureus, right, 40 pmol) for 5, 10, 20, and 30 min. (b) Phosphotransfer reaction was performed from YycG (S. aureus, 25 pmol) to YycF (S. aureus, left, 40 pmol) or YycF (8. subtilis, right, 40 pmol) for 5, 10, 20,. and 30 min.. Isolation and characterization of B. subtilis YycF mutant B. subtilis strain CNM2000, which carries the H215P mutation in YycF (the response. regulator of YycG-YycF TCS), was constructed by site-directed mutagenesis in this study. As previously reported [Fabret and Hoch, 1998], this mutant has a ts phenotype in growth. The H215P mutation is located on the loop connecting the a3 helix to the and. ~7. ~6. C-terminal strands of YycF. Substitution of a proline for a histidine at the site. may perturb the DNA-binding properties at an elevated temperature [Fabret and Hoch, 37.

(44) 1998]. Upon a shift to 47°C, the CNM2000 strain stopped growing after approximately 30 min and afterward the cell turbidity at OD600 decreased. We examined the sensitivity of the B. subtilis CNM2000 mutant to cefazolin, amikacin, vancomycin, erythromycin, ofloxacin, and NH127 (3-benzyl-l-Iauryl-2methylimidazolium iodide) [Yamamoto et al., 2000, 2001]. The growth of CNM2000 was found to be more sensitive than that of the B. subtilis wild-type 168 to only the antibacterial agent NH127, an HK inhibitor (Fig. 3). B. subtilis YycG was inhibited by NH127, but not by cefazolin, amikacin, vancomycin, erythromycin, and ofloxacin (Fig. (a). B. subtilis 168. B. subtilis CNM2000. (b) B. subtilis CNM2000. B. subtilis 168. Fig. 3. Sensitivity of B. subtilis 168 and CNM2000 to the antibacterial agents. (a) NHI27 was bioassayed using 168 (left) and CNM2000 (right) as described in the text. One microliter of NHI27 at six concentrations. (~g/ml). was spotted on Trypticase Soy agar plates containing 168 or CNM2000: 5000 (1),. 500 (2), 50 (3)," 5.0 (4), 0.5 (5),0.05 (6). (b) Cefazolin (1), amikacin (2), vancomycin (3), erythromycin (4), otloxacin (5), and NHI27 (6) were bioassayed using 168 (left) and CNM2000 (right) as described in the text. One microliter of each antibacterial agent (50 agar plate containing 168 or CNM2000.. 38. ~g/ml). in DMSO was spotted on Trypticase Soy.

(45) 4). Furthermore NH127 inhibited autophosphorylation of YycG from both B. subtilis and S. aureus with the lC so of 22.4 and 48.8 I..I.M, respectively (Fig. Sa and 5b) although MAP kinase was not affected under the same conditions at all (Fig. 5d). Phosphotransfer from phosphorylated YycG to YycF of B. subtilis was also inhibited by NH127 with the lC so of25.61..1.M (Fig. 5c).. 1. 2. 4. 3. 5. 6. 7. Fig. 4 .. Effect of the antibacterial agents on YycG autophosphorylation. Autophosphorylation of YycG purified from B. subtilis was performed in the presence or absence of the antibacterial agents (50 Ilg/ml) ; lanes 1-7 contain cefazolin, arnikacin, vancomycin, erythromycin, ofloxacin, NH 127, and DMSO. (control), respectively.. 39.

(46) aranorosinol B. NH127 I. 2. ... •. (b) YycG (S. aureus). (d) p42 MAP kinase. 5 6 7 8 9 10. -I ---------1. (a) YycG (B. subtilis). (c) YycG-YycF (B. subtilis). 3 4. . .. 2. _a. II 12 13 14 15 16 17 18 19 20. III. ,w". -I ... . _aw.· "I. ---- ---~ I ,. I. •. w.. 'wi+-. Yy<G. ~ - .~ YycF. _ _. (. Fig. 5. Autophosphorylation, phosphotransfer, and p42 MAP kinase assays. Autophosphorylation of YycG purified from B. subtilis (a) and S. aureus (b) and phospho transfer from phosphorylated YycG (B. subtilis) to YycF (B. subtilis) (c) and p42 MAP kinase assay (d) were performed in the presence or absence of NH 127 (lanes 1-10) or aranorosinol B (lanes 11-20) at nine concentrations. (~g/ml):. lane 1,. 50.0; lane 2, 25.0; lane 3,12.5; lane 4, 6.25; lane 5, 3.13 ; lane 6,1.56; lane 7, 0.78; lane 8, 0.390; lane 9, 0.190; lane 10, vehicle control (DMSO); lane II , 1000; lane 12, 500; lane 13,250; lane 14, 125; lane 15, 62.5; lane 16,31.3; lane 17, 15.6; lane 18, 7.80; lane 19, 3.90; lane 20, vehicle control (DMS O). In (c), after phosphorylation of YycG, drugs were added and then reacted with YycF as described in Materials and Methods.. 40.

(47) Isolation and characterization of natural antibacterial agents that inhibit YycG histidine kinase Since the B. subtilis mutant CNM2000 with YycF (H215P) mutation is highly sensitive to the HK inhibitor NH127 (Fig. 3), we used this strain for the screening of YycG inhibitors. For this purpose, acetone extracts from 4000 microbes were used in a bioassay of CNM2000 growth. A total of 11 samples showed greater activity against CNM2000 than strain 168. Seven of those samples significantly inhibited the autophosphorylation activity of YycG HK; the other four samples were only weakly active (data not shown). Starting with the most potent extract from the microbe WF140196, identified as Gymnascella dankaliensis (former name: Pseudoarachniotus roseus), a compound was purified, that was more potent against CNM2000 versus strain 168 [see Materials and Methods for details of the purification process]. The identification of WF140196 as aranorosinol B [Roy et al., 1992] was done by the comparison of l3C NMR data. The l3C NMR spectrum of WF140196 was measured in the same D-solvent system (CDCh-C6D6 (3:1» as used by Roy et al. and the data were listed in Table 3 together with those of aranorosinol B. The data observed were in good agreement with the reported values within the range of experimental errors, identifying WF140196 as aranorosinol B (Fig. 6a). The purified aranorosinol B inhibited the autophosphorylation of YycG from both B. subtilis and S. aureus with IC 50 of 223 JlM and 211 JlM, respectively (Fig. 5a and 5b), and the MAP kinase reaction with IC50 of 1477 J.1M (Fig. 5d). Aranorosinol B also inhibited phosphotransfer from phosphorylated YycG (R. subtilis) to YycF (B. subtilis) with IC 50 of 223 JlM (Fig. 5c). As expected, the mutant CNM2000 was more sensitive to the purified aranorosinol B than the wild-type strain 168 (Fig. 6b). Aranorosinol B, which had been isolated from Pseudoarachniotus. 41.

(48) roseus [Roy et aI., 1992], did not show antibacterial activity against gram-negative. bacteria including E. coli and Pseudomonas aeruginosa, but MICs against S. au reus and B. subtilis were 31.25 and 15.62. ~g/ml,. respectively, which were also obtained in this. study. The ts growth assay described here is presently being used in our laboratory for high-throughput screening for the identification of HK inhibitors and is of value in the subsequent stages of lead identification involving iterative rounds of chemical refinement.. Table 3. Comparison of 13C NMR Spectrum.a) position. 2 3 4 5 6 7 8 9 10 1' 2' 3' 4' 5' 6' 7'. 8' 9' 10' 11' 4'- CH3 6'- CH3 11 '-CH3 1" 2" 3". aranorosinol B WF140196. 96.7 52.4 37.1 79.0 59.6 58.2 66.4 57.5 58.7 166.9 117.9 146.9 131.1 147.7 33.3 37.4 27.6 29.6 32.0 22.8 12.6 20.5 14.1 47.5 210.4 31.5. 96.4 52.1 37.3 79.1 59.3 58.0 66.3 57.3 58.5 166.5 117.4 147.0 130.9 148.0 33.2 36.9 27.6 29.5 31.9 22.7 12.5 20.6 14.1 47.0 210.4 31.4. difference. 0.3 0.3 -0.2 -0.1 0.3 0.2 0.1 0.2 0.2 0.4 0.5 -0.1 0.2 -0.3 0.1 0.5 0.0 0.1 0.1 0.1 0.1 -0.1 0.0 0.5 0.0 0.1. a) These chemical shifts were obtained from l3C NMR spectrum.. 42.

(49) gH O~~f,~3. (a). 8 9. 0. /",. /",. /",. 6 ~ 4 /.:".. H F~. ~ T. 'I. 4. Jl... ,,-. ~. CH 3 CH 3. o. 6. I' ~. 0. 0. 5. 2. 0. OH. (b) B. subtili.' CNM2000. B. subtilis 168. Fig. 6. Bioassay of aranorosinol B. (a) Chemical structure of aranorosinol B. (b) Purified aranorosinol B was bioassayed using 168 (left) and CNM2000 (right) as described in the tex t. One microliter of aranorosinol B at six concentrations. ( ~g/~I ). wa s spotted on Trypticase Soy agar plates containing 168 or. CNM2000:10.0 (I), 5.00 (2), 2.50 (3), 1.25 (4), 0.625 (5), 0.3 13 (6).. A mode of action of aranorosinol B Although aranorosinol B did not show antibacterial activity against gram-negative bacteria, NH127 possessed antibacterial activity against both gram-positive and gram-negative bacteria [Yamamoto et al. , 2000, 2001]. To investigate the potential difference in the mode of action of aranorosinol B and NH127, we investigated the activity of these two compounds as inhibitors of HK autophosphorylation across a total of 19 sensor kinases from E. coli. The results are summarized in Table 4. A group of sensor kinases including CheA, CpxA, DeuS , PhoQ, and TorS were more sensitive to NH127 than to aranorosinol B, while other groups such as EvgS , UhpB and YedV were. 43.

(50) more sensitive to aranorosinol B than to NH127. These results suggest that the relative activities of these two agents against the different groups of sensor kinases could be a basis for their different antibacterial properties. To understand the mode of action of aranorosinol B, we performed docking analysis of aranorosinol B against EnvZ, a histidine kinase structurally similar to YycG. The absolute structure of aranorosinol B has not been determined yet. A biosynthetic precursor (aranorosin) [Roy et aI., 1992] could give two possible aldols as metabolites. To distinguish these structures, I named them aranorosinol B-1 and -2 as shown in Figs. 7a and 8. Both of the possible structures were evaluated the binding against EnvZ. As a result, aranorosinol B is possible to bind ATP-binding pocket of EnvZ (Front views of Figs. 7a and 8).. Table 4. Effects of aranorosinol Band NH127 on E coliHKs. HKs. IC so ( J.l.M ). Ratio (alb). aranorosinol Ba NH127 b ArcB BaeS. 469 274. BarA. 706. BasS CheA. 224 1,407. CpxA CreC. 11,186< 213. CusS DeuS EnvZ EvgS HydH PhoQ. 761 2,868 515. 11,186<. PhoR RstB. 338 190. TorS UhpB YedV YfhK. 189 1,084. 125. 3.75. 109. 2.51 1.22. 577 158. 1.42. 88 173. 15.99 64.66. 149 160. 1.43 4.76. 136 185. 21.09. 387. 0.49 5.92. 183 101 297. 2.78. 110.75 1.14. 183. 1.04. 11,186< 101 78. 213. 52.52. 170 122. 0.59 0.64. 172. 167. 1.03. 44.

(51) (a). .. Q. :'<:. HO. o o .. .. 00. 0. )-(OH H. aranorosinol B-1. (b). NH,. o. 0. (1]\. 0. N. I I Ilf HO-P-O-P-O-P0 j I. I. I. o· o· o·. ~. HOH. NH,. ;]\N. o. 0. 0. IHI I HO-P-p-o-p-o I. 0-. I. I. ti. N. 0. o· o·. OH. HOH. ATP. OH. ANP. Fig. 7. A binding model of aranorosinol B-1 against ATP-binding domain of EnvZ. (a) ANP, a competitive ATP inhibitor. Aranorosinol B-1 (# I to #5) indicates each conformer of aranorosinol B. (b) Structures of ATP and ANP.. 45.

(52) aranorosinoI B-2 Fig. 8. A binding model of aranorosinol B-2 against ATP-binding domain of EnvZ. Aranorosinol 8-2 (# I to #5) indicates each confonner of aranorosinol B.. 46.

(53) CHAPTER IV. Conclusion. In this thesis, we revealed that YycF response regulator plays an important role in the. essential YycG-YycF system, and developed sensitive genetic screening method for inhibitors of the essential YycG histidine kinase. Furthermore, we isolated and characterized aranorosinol B that showed antibacterial activity against gram-positive bacteria such as Bacillus subtilis and Staphylococcus au reus and inhibited autophosphorylation activity of YycG. In CHAPTER II, we demonstrated that histidine residue at 215 in YycF is essential. for the function of YycG-YycF system. We purified YycG, YycG (H386A), YycF, and YycF (H215P) and performed in vitro phosphorylation. As a result, YycG was autophosphorylated in the presence of [y_32 p ]ATP, but YycG (H386A) was not. Furthermore, YycF and YycF (H215P) were phosphotransfered from YycG-P. These results demonstrated that YycG is autophosphorylated at His 386 and YycG-P transfers the phosphate to cognate YycF in vitro. On the other hand, the secondary structure of YycF (H215P) was significantly affected as compared with that of YycF at 20°C and Tm values of YycF and YycF (H215P) were calculated to be 56.0°C and 45.9°C, respectively. In addition, YycF (H215P) was not able to bind to PI promoter of !tsAZ operon regulated by Y ycG-YycF and to form a homodimerization. These results were described that B. subtilis CNM2000 was temperature-sensitive at 47°C because YycF (H215P) did not form a homozimerization in B. subtilis CNM2000 and did not bind to the promoter region of target genes such as!tsAZ operon and yocH with the DNA motif. 47.

(54) (5'-TGT Aff A Aff/C-N5-TGT Aff A Aff/C-3' ) as shown in Fig. 1.. B. subtilis 168. B. subtilis CNM2000. Inner membrane. YycG. 1. AT?. Autophosphorylation. Inner membrane. YycG. Autophosphorylation. AD?. YycF ( ......_~). ... _..... Phosphorylation. YycF (H215P) :: •••.....•:. Phosphorylation. 1. ~. /. Regulation of transcription. ~. ~. -- The prom~r region of!tsAZ. ..... .•......... ..®-.....: :. . ..... ! •••••• 1Ii.(:p):. ~ - - - ....... ,. ~ The promoter region of!tsAZ. TGT-Arr-A-AmC-N5-TGT-Arr-A-Amc. Fig. 1. A model ofYycG-YycF system in B. subtilis 168 and CNM2000.. In CHAPTER III, we developed a screening method for inhibitors of YycG-YycF. system and isolated aranorosinol B, one of acetone extracts from 4000 microbes. Aranorosinol B inhibited autophosphorylation of YycG from both B. subtilis and S. aureus with an IC so of 223 and 211 JlM, respectively and MICs against S. aureus and B. subtilis were 31.25 and 15.62 Jlg/ml, respectively. Furthermore, aranorosinol B. inhibited 16 histidine kinases from E. coli, but did not inhibit CpxA, PhoQ, and TorS. On the other hand, NH127 inhibited all of 19 histidine kinases that were used in this study. We considered that the relative activities of these two agents against the different groups of histidine kinases could be a basis for their different antibacterial properties. In addition, aranorosinol B is possible to bind ATP-binding pocket of EnvZ, a histidine. 48.

(55) kinase structurally similar to YycG, by docking analysis of aranorosinol B against EnvZ using Autodock v3.0.S. These results demonstrated that aranorosinol B bound to ATP-binding region of YycG and inhibited autophosphorylation of YycG (Fig. 2). The ts growth assay described here is presently being used in our laboratory for high-throughput screening for the identification of HK inhibitors and is of value in the subsequent stages of lead identification involving iterative rounds of chemical refinement.. No Inhibition. Inhibition. ........ A TP-binding domain. ~. Fig. 2. A mode of action of aranorosinol B against YycG.. 49.

(56) ACKNOWLEDGMENTS. I wish to express my sincerest gratitude to Professor Dr. Ryutaro Utsumi, Department of Bioscience and Biotechnolgy, Graduate School of Agriculture, Kinki University, for kind guidance, valuable suggestion and discussions, and continuous encouragement throughout the course of this work and critical reading of the manuscript. Special thanks are due to Drs. Tadashi Okamoto and Tamo Fukamizo, Professor of Department of Bioscience and Biotechnolgy, Graduate School of Agriculture, Kinki University, for reading the entire text in its original form. I also wish to express my sincerest acknowlegment to Assosiate Professor Dr. Hiroyuki Tanabe, Department of Agicultural Chemistry, Kinki University, and Assistant Professor Ph. D. Kaneyoshi Yamamoto, Department of Agicultural Chemistry, Kinki University, for their useful discussions and technical advices. I am grateful to Daniel Ladant for generously supplying me with derivatives of pT18 and pT25 plasmids and DHPI strains, and Robert Novy for generous supplying me with pKWY2428 plasmid. I would also like to thank Dr. Hirofumi Yoshikawa, Laboratory of Microbiology and Molecula Genetics, Tokyo University of Agricultute, for providing B. subtilis 168; Dr. Mitsuhiko Itaya, Mitsubishi Kasei Institute of Life Sciences, for providing drug-resistant genes for B. subtilis, pBEST501 and pBEST4C. I thank Drs. Motohiro Hino, Akihiko Fujie, Yasuhisa Tsurumi and Shigehiro Takase, Exploratory Research Laboratries Fujisawa Pharmaceutical Co., Ltd., for supplying acetone extracts from 4000 microbe, and identification of G. dankaliensis and aranorosinol B.. 50.

(57) Special thanks are due to Drs. Masayuki Matsushita, Assistant Professor of The Scripps Research Institute, for the docking experiments of aranorosinol B against EnvZ and valuable suggestion and technical advices.. Finally, I am great indebted to Yoshiki Hashimoto, Yoshihito Umemoto, Daisuke Tatebe, and other members of Department of Bioscience and Biotechnolgy, Graduate School of Agriculture and Department of Agicultural Chemistry, Kinki University.. 51.

(58) REFFERENCES. Arora, S., Yang, J. -M., Kinzy, T. G., Utsumi, R, Okamoto, T., Kitayama, T., Ortiz, P. A., and Hait, W. N. (2003) Identification and characterization of an inhibitor of. eukaryotic elongation factor 2 kinase against human cancer celllines. Cancer Res. 63: 6894-6899.. Barrtte, J. F. and Hoch, J. A. (1998) Two-component signal transduction as a target for microbial anti-infective therapy. Antimicrob. Agents Chemother. 42: 1529-1536.. Barrette, J. F. et al. (1998) Antibacterial agents that inhibit two-component signal transduction systems. Proc. Natl. Acad. Sci. USA 95: 5315-5322.. Beier, D. and Frank, R (2000) Molecular characterization of two-component systems systems of Helicobacter pylori. J. Bacterial. 182: 2068-2076, 2000. Clausen, V. A., Bae, W., Throup, J., Burnham, M. K. R, Rosenberg, M., and Wallis, N. G. (2003) Biochemical characterization of the first essential two-component signal transduction system from Staphylococcus aureus and Streptococcus pneumoniae. J. Mol. Microbiol. Biotechnol. 5: 252-260.. Cohen, M. L. (2000) Changing patterns of infectious disease. Nature 406: 762-767.. 52.

(59) Eguchi, Y., Oshima, T., Mori, H., Aono, R., Yamamoto, K., Ishihama, A, and Utsumi, R. (2003) Transcriptional regulation of efflux genes by EvgAS, a two-component. system in Escherichia coli. Microbiology 149: 2819-2828.. Fabret, C. and Hoch, J. A (1998) A two-component signal transduction system essential for growth of Bacillus subtilis: Implications for anti-infective therapy. J. Bacterio!. 180: 6375-6383.. Fabret, C., Feher, V. A, and Hoch, J. A (1999) Two-component signal transduction in Bacillus subtilis: How one organism sees its world. J. Bacterio!. 181: 1975-1983.. Fisher, S. L., Jiang, W., Wanner, B. L., and Walsh, C. T. (1995) Cross-talk between the histidine kinase VanS and the response regulator PhoB: Characterization and identification of a VanS domain that inhibits activation of PhoB. J. Bio!. Chern. 270: 23143-23149.. Fukuchi, K., Kasahara, Y., Asai, K., Kobayashi, K., Moriya, S., and Ogasawara, N. (2000) The essential two-component regulatory system encoded by yycF and yycG modulates expression of the !tsAZ operon in Bacillus subtilis. Microbiology 146: 1573-1583.. 53.