Peak 1 of reassembled Venus and peak 3b of reassembled Venus are indicated solid line and dashed line, respectively
3. Results and discussion
Based on its retention volume in size exclusion chromatography (Fig. 6) and MALDI-TOF MS data (Table 2), peak 1 was elucidated to be a monomer of reassembled Venus. The structure of the species corresponding to peak 1 was confirmed by X-ray structure analysis. The retention volume indicated that peak 2 was also a monomer of reassembled Venus. However, the molecular weight of VN155 found in MS is approximately 180 Da larger than the calculated value (Table 2). These results suggested that a part of reassembled Venus might be modified during incubating in E. coli.
DLS data (Table 3) indicated that peak 3 was a molecular aggregate which have a molecular weight corresponding to an octamer of reassembled Venus. However, as previously indicated in CHAPTER I, this octamer is converted to a monomer in an irreversible manner or the rate of conversion to oligomer is extremely slow.
The crystal structure of monomeric reassembled Venus was determined at 2.1 Å resolution. There are four reassembled Venus molecules formed through the association of two VN155 and VC155 fragments in an asymmetric unit (Fig. 14). Each molecule has an eleven-stranded β-barrel fold including a chromophore in the middle, typical of GFP-derived fluorescent proteins. The four molecules form two antiparallel
concentration of protein and in high-salt concentration. The dimer structure may be stabilized in crystals. The locations of the residues surrounding the chromophore of reassembled Venus are quite similar to those surrounding the chromophore of whole Venus (Fig. 16). Fluorescent spectrum of reassembled Venus was identical to whole Venus (Fig. 7). There is no difference between the environment surrounding chromophore of reassembled Venus and that of whole Venus.
In the β-barrel fold between reassembled Venus and whole Venus, a slight but significant difference was found. R.m.s.d. values of the mainchain calculated using LSQKAB with monomer of reassemble and whole Venus are 0.59 Å for N-terminal fragment (amino acid residues 1-154) and 1.66 Å for C-terminal fragment (amino acid residues 155-230), respectively. As compared with whole Venus, the seventh β-strand (β7) of reassembled Venus is shortened (Figs. 17 & 18). Unlike whole Venus, two amino acid residues, Asn146 and Ser147, didn’t contribute to form β7. The loop (amino acid residues from 138 to 147) of reassembled Venus was expanded and more flexible than that of whole Venus by lacking of hydrogen bonds between β7 and β10.
This means that the formation of the β-barrel structure of reassembled Venus is partially insufficient.
Table 2 TOF-MS of reassembled Venus.
Comparison between the found and calculated masses of proteins.
Table 3 Hydrodynamic Radii, polydispersity values (Pd%) and molecular weight of reassembled Venus, as determined by DLS analysis.
peak1
Found Calculated
VN155 VC155 VN155 VC155
19925
19920 10558 10552
20104 10553 19917 10552 peak2
peak3
peak1
Radius (nm) %Mass Mw (kDa)
2.5 6.3
30 245 100.0
99.8 peak3
%Pd 13.2 19.1
Polymerization monomer octamer
Fig. 14 Crystal structure of reassembled Venus.
Ribbon diagram of a tetramer of reassembled Venus, which consists of VN155 (Chain A, C, E, G) and VC155 (Chain B, D, F, H).
Chain A
Chain B Chain E
Chain F
Chain C Chain D Chain G
Chain H
Chain A
Chain B Chain E
Chain F
Chain C Chain D Chain G
Chain H
Chain A
Chain B Chain E
Chain F
Chain C Chain D Chain G
Chain H
Fig. 15 Superposition of the main chain of the dimer structure of reassembled (yellow) and whole Venus (cyan).
chromophore Tyr203
His148
Asn146
Ser205 Glu222 Thr62
Arg96
Gln94
Fig. 17 Comparison of reassembled Venus and whole Venus.
Whole Venus is represented in cyan. VN155 and VC155 of reassembled Venus are represented in orange and yellow, respectively.
Fig. 18 β β β β7 of reassembled Venus is shorter than that of whole Venus.
Hydrogen bond (dashed line) between β7, β10 and β11of reassembled (yellow) and whole Venus (cyan).
β ββ β7 β ββ β8 β β ββ9
βββ β10
ββ ββ11
β ββ β7 β β ββ8 β β ββ9
βββ β10
βββ β11 β
β
ββ4 ββββ4
C
C N
N
C N
ββ ββ7
β β ββ10
βββ β11
β ββ β7
ββ ββ10
β ββ β11
CHAPTER III
Thermal stabilities and reassembly mechanism
1. Introduction
Since the identification of the GFP from jellyfish Aequorea victoria in the early 1990s, a large number of fluorescent proteins have been isolated from natural sources, primarily from marine animals and corals (Hsu et al., 2010). mFruits are second-generation mRFPs that improved brightness and photostability compared to the first-generation mRFP1 (Shu et al., 2006). mCherry (λex = 587 nm, λem = 610 nm) derived from Discosoma sp. (Figs. 19 & 20), has been developed for its fast chromophore maturation rate as same as yellow fluorescent protein, Venus (Shaner et al., 2004). The brilliant redness, short maturation time, and the long excitation and emission wavelengths of mCherry make the new BiFC system for analyzing protein– protein interactions in living cells and for studying multiple protein–protein interactions when coupled with other BiFC systems. This new red BiFC system was developed by splitting mCherry, into two fragments between amino acids 159-160 as well as splitting Venus.
To confirm whether reassembled mCherry forms an oligomer as well as
Fig. 19 Discosoma sp.
Fig. 20 Crystal structure of whole mCherry. (PDB: 2H5Q)
2. Materials and Methods
2-1. Preparation of mutants
Three mutants of VN155 (Y143F, Y145F, H148G) were constructed by site-directed mutagenesis of plasmids carrying VN155 (pET-16b) by PCR using Pfu Turbo (Stratagene) and primers (Table 4). The sequence of mutants were verified by DNA sequencing with a dye terminator cycle sequencing kit (Beckman Coulter) and a CEQ2000 fragment analysis system (Beckman Coulter). Reassembled Venus consisting of VN155 mutants and VC155 (denoted as rV-Y143F, rV-Y145F, rV-H148G) were coexpressed and purified by the same procedures as those used for reassembled Venus.
2-2. DSC measurement
Calorimetric experiments were carried out with a nanoDSC (TA instruments).
Samples were prepared in concentrations of 0.5 and 1.0 mg/mL. The buffer used for the sample was 20 mM sodium phosphate, pH 7.0. Experiments were performed over a temperature range of 25-95ºC at a scan rate of 1 ºC/min and excess pressure of 2.8 atm.
2-3. Preparation of mCherry
in E. coli strain BL21(DE3) bacteria (Novagen). Whole mCherry (amino acid residues 1-238) was subcloned into pRSET-B plasmid and expressed in E. coli strain BL21(DE3)pLysS bacteria. Cells were grown using LB broth in a shaker incubator at 37ºC. Expression was induced with 0.5 mM IPTG at O.D.600nm of 0.5 and cultivation was continued for a further 12 h at 22ºC.
Cells of reassembled mCherry were harvested and resuspended in 50 mM sodium phosphate buffer,pH 8.0, containing 300 mM NaCl and 10 mM imidazole.
After sonication and centrifugation, the supernatant was loaded onto a Ni-NTA column equilibrated with 20 mM Tris-HCl buffer, pH 8.0, containing 150 mM NaCl (buffer A) and eluted with 250 mM imidazole. The fractions containing reassembled Venus were combined and concentrated. Reassembled mCherry was finally purified by the gel filtration chromatography using a Superdex 200 column (GE Healthcare) equilibrated with 20 mM sodium phosphate buffer, pH 7.0.
Cells of whole mCherry were harvested, resuspended in buffer A, and sonicated.
The lysate was centrifuged to obtain a crude sample. The supernatant was loaded onto a DEAE sepharose ion-exchange column (GE Healthcare) equilibrated with buffer A and eluted with a linear gradient of NaCl (100-700 mM). Whole mCherry samples were eluted in the wash buffer. Whole mCherry samples were further purified by a size exclusion chromatography using Superdex 200 (Fig. 6d).
2-4. HPLC analysis of Venus and mCherry
Whole Venus, reassembled Venus, whole mCherry and reassembled Venus were examined by HPLC analysis at room temperature. HPLC analysis was performed using L-6200 Intelligent Pump (HITACHI), ELITE LaChrom L-2400 UV Detector (HITACHI), D-2500 Chromato-Integrator (HITACHI). Columns were TSKgel SuperSW2000 4.5*300 (TOSOH) and TSK guardcolumn SuperSW 4.6*3.5 (TOSOH).
mCherry and Venus were detected at 587 nm and 515 nm, respectively.
Table 4 List of primers.
Y143F forward 5’- CACAAGCTGGAGTTCAACTACAACAGC -3’
Y143F reverse 5’- GCTGTTGTAGTTGAACTCCAGCTTGTG -3’
Y145F forward 5’- GGAGTACAACTTCAACAGCCACAAC -3’
Y145F reverse 5’- GTTGTGGCTGTTGAAGTTGTACTCC -3’
H148G forward 5’- CAACTACAACAGCGGCAACGTCTATATC -3’
H148G reverse 5’- GATATAGACGTTGCCGCTGTTGTAGTTG -3’
3. Results and discussion
Based on this structural features, mutations in β7 of VN155, Y143F, Y145F and H148G (Figs. 21 & 22), were introduced to see if any change in the thermal stability of reassembled fluorescent complex is observed.
DSC studies were carried out on whole Venus, reassembled Venus and mutants (Fig. 23, Table 5). The profiles were analyzed mainly in terms of the peak temperatures, because all of the samples showed irreversible transition. The thermogram of whole Venus shows a sharp single peak at 89.0ºC (Tm). On the other hand, the thermogram of monomeric reassembled Venus shows a sharp single peak at a lower temperature of 77.5ºC. The Tm value of the monomeric reassembled Venus did not fall at a lower concentration of 0.1 mg/mL. It can therefore be presumed that the dissociation and the thermal denaturation of monomeric reassembled Venus occur simultaneously at around Tm value.
The thermograms of three mutants of reassembled Venus, rV-Y143F, rV-Y145F and rV-H148G, showed Tm values of 77.1ºC, 83.8ºC and 72.1ºC, respectively (Table 5, Fig. 23). The OH group of Tyr143 forms a hydrogen bond with the carbonyl O atom of Ser208 (Fig. 22a). Despite the hydrogen bond is lacking, Tm value of the rV-Y143F mutant was the almost same as that of reassembled Venus. Surprisingly, the substitution of Tyr145 with phenylalanine enhanced the thermal stability compared with monomeric reassembled Venus. Tyr145 and His169 are linked by the hydrogen bond network through two water molecules (Fig. 22b). The substitution seems to cause the release of one water molecule and increase the hydrophobic core with juxtaposed
hydrophobic amino acids, Val61 and Ile167, or cause the rearrangement of those amino acids into alternative dense-packing structure. In contrast, the significant decrease in thermal stability was observed when His148 was substituted with glycine. This mutant seems to be useful for BiFC assay, because the lacking of the hydrogen bonds (Fig.
22c) may weaken the binding force between N- and C-fragments of Venus.
DSC measurement for the oligomer of reassembled Venus showed two peaks;
one peak is identical to that for the monomer of reassembled Venus and has a maximum at 77.6ºC, and the other peak spreads through the range from 40ºC to 65ºC (Fig. 24, cyan). The size exclusion chromatography indicated that the oligomer was readily converted to the monomer. Thus, it can be considered that the conversion from oligomer to monomer occurs while temperature rises to ~65ºC.
HPLC analysis was carried out on whole Venus, reassembled Venus, whole mCherry and reassembled mCherry to confirm whether reassembled mCherry forms an oligomer as well as reassembled Venus. Reassembled mCherry is a split red fluorescent protein at amino acid residue 159/160. The size exclusion chromatography of whole mCherry yielded one peak as same as whole Venus (Fig. 25). On the other hand, the chromatography of reassembled mCherry yielded two peaks as same as reassembled Venus. It is concluded reassembly of split fluorescent proteins is a consequence of
of mCherry has a great thermal stability compared to those of Venus.
BiFC assay utilizes the formation of the fluorescent complex through the association of two non-fluorescent N- and C-terminal fragments of the fluorescent protein when they are brought together by an interaction between two target proteins fused to the fragments. Thus, oligomerization will not be preferable for BiFC assay, because it will prevent the interaction between two target proteins and increase background. In the β-strand swapping, it has been also reported that proline residues play an important role (Bergdoll et al., 1997). The cis-trans proline isomerization, a very low energy barrier, is a relatively slow process that can affect the protein folding pathway. Interestingly, reassembled Venus has three proline residues, Pro187, Pro192 and Pro196, and mCherry has two proline residues, Pro186, Pro190, on the loop region between β9 and β10 (Fig. 27) and they seem to play a critical role in the domain, including β10- and β11-strands or β8- and β9-strands, swapping. It is suggested that replacing a proline with another amino acid should depress the formation of oligomers.
Here, the author proposes the model of reassembly mechanism of fluorescent protein (Fig. 28). After coexpression in E. coli, most of VN155 and VC155 form a metastable oligomer by β-strand swapping as described above. Then, this oligomer is converted irreversibly to a more stable monomer. However, ∆H of oligomer (16.3 KJ/mol) was lower than that of monomer (22.9 KJ/mol). It is suggested that a part of oligomer disaggregates and is unable to form a monomer by misfolding.
Fig. 21 Three mutants of VN155 of reassembled Venus.
Y143F Y145F
H148G
Y143F Y145F
H148G
Fig. 22 Close-up views of three amino acids around β β β7. β
Hydrogen bonds are indicated by dashed lines. Water molecules are drawn with pink spheres. (a) Tyr143. (b) Tyr145. (c) His148.
Tyr143
Ser208
His169
Tyr145
His148
chromophore
Arg168
(a) (b)
(c)
Fig. 23 DSC of whole and reassembled Venus and its mutants.
Heat capacity curves for whole Venus (black), peak 1 of reassembled Venus (red), Y143F (green), Y145F (pink), H148G (blue).
Table 5 Comparison of T
mvalue (ºC).
20 30 40 50 60 70 80 90 100
Excess Heat Capacity
Temperature / oC
20 kJ K-1 mol-1
reassembled Venus 77.5 Mutant rV-Y143F 77.1
rV-Y145F 83.8
Fig. 24 DSC of reassembled Venus.
Heat capacity curves for peak 1 of reassembled Venus (red) and peak 3 of reassembled Venus (cyan).
20 30 40 50 60 70 80 90 100
Excess Heat Capacity
Temperature / oC
20 kJ K-1 mol-1
peak 1 peak 3
∆H = 22.9 KJ/mol
∆H = 16.3 KJ/mol
Fig. 25 Chromatogram of whole (top) and reassembled mCherry whole mCherry
reassembled mCherry
0 20 min
retention time
Fig. 26 DSC of Venus and mCherry.
Heat capacity curves for peak 1 of reassembled Venus (green), whole mCherry (pink), reassembled mCherry (blue), respectively.
30 40 50 60 70 80 90 100 110
60 80 100 120 140 160
kJ K-1 mol-1
Temperature / oC VNVC1 1.0 mg/ml
cherry 1.0 mg ml cherryR 1.0 mg/ml