R5'TCGGCCTTCCACTCTAGCAT3' 588‑594 F5'TGCACAAGATTCTTGT(K}TTATCG3' 572‑579
4.5 REIERENCES
e Bao, J., Alroy, I., Waterman, H., Schejter, E. D., Brodie, C., Gruenberg, J., and Yarden, Y., 2000. Threonine phosphorylation diverts internalized epidermal growth factor receptors from a degradative pathway to the recycling endosome, X BioL enem. 275,
26178‑26186.
e Boudrez A, Beullens M., Waelkens E., Stalmans W., Bollen M., 2002. Phosphorylation‑
dependent interaction between the splicing factors SAP155 and NIPPI. .J: BioL enem.
277 31834‑31841.
'
e Countaway, J. L., Nairn, A. C., and Davis, R. J., 1992. Mechanism ofdesensitization of the epidermal growth factor receptor protein‑tyrosine kinase. X BioL enem. 267, 1129‑
1140.
e Diamonti, A. J., Guy, P. M, IvanoC C., Wong, K., Sweeney, C., and Carraway, K. L., 3rd. 2002. An RBCC protein implicated in maintenance of steady‑state neuregulin receptor levels. Proc. IVbtl. Acaa SZri. US14 99, 2866‑2871.
e Elenius, K., Corfas, G, Paul, S., Choi, C. J., Rio, C., Plowman, G D., and Klagsbrun,
M, 1997. A Novel Juxtamembrane Domain isoform of HER4AErbB4. Isoforrn‑specific
tissue distribution and diffbrential processing in response to phorbol ester. uL BioL Chem.272 26761‑26768.
'
e Junttila T.T., Sundvall M, Lundin M., Lundin J., Tanner M., Harkonen P., Joensuu H., lsola J., and Elenius K., 2005. Cleavable ErbB4 isofbrrn in estrogen receptor‑regulated growth ofbreast cancer cells, CZzncerRes. 65, 1384‑1393.
e Kaida D., Motoyoshi H., Tashiro E., Noj ima T., Hagiwara M., Ishigami K., Watanabe H.,
Kitahara T., Yoshida T., Nakajima H., Tani T., Horinouchi S., Yoshida M, 2007.
Spliceostatin A targets SF3b and inhibits both splicing and nuclear retention of pre‑
mRNA. A127ture Chem. Biol. 3 576‑583.
'
105
Chupter 4
e Morrison, P., Takishima, K., and Rosner, M. R., 1993. Role of threonine residues in regulation of the epidermal growth factor receptor by protein kinase C and mitogen‑
activated protein kinase.1: BioL Chem. 268, 15536‑15543.
e Lee H‑J., Jung K‑M., Huang Y.Z., Bennett L.B., Lee J.S., Mei L., Kim T‑W., 2002.
Presenilin‑dependent y‑secretase‑like intramembrane cleavage of ErbB4. X BioL enem.
277 6318‑6323.
'
e Linggi B., Cheng Q.C., Rao AR., Carpenter G., 2006. The ErbB4 s80 intracellular
domain is a constitutively active tyrosine kinase. Oncogene 25, 160‑163.e Ni C‑Y., Murphy MP., Golde T.E., Carpenter G, 2001. y‑secretase cleavage and nuclear localization ofErbB4 receptor tyrosine kinase. Science 294, 2179‑2181 .
e Qiu, X. B., and (]ioldberg, A. L. 2002 NrdplZFLRF is a ubiquitin ligase promoting ubiquitination and degradation of the epidermal growth factor receptor family member, ErbB3. Proc. IVbti. Acact Sbi. USL4 99, 14843‑14848.
e Seghezzi W., Chua K, Shanahan F., (fozani O., Reed R., and Lees E., 1998. Cyclin E associates with components of the pre‑mRNA splicing machinery in mammalian cells.
MoL CellBioL 18 45264536.
'
e Stortelers C., Souriau C., van Liempt E., van de Poll M.L., van Zoelen EJ, 2002. Role of the N‑terminus of epidermal growth factor in ErbB‑2LErbB‑3 binding studied by phage display, Biochemistry 41, 8732‑8741.
e Tomic, S., Greiser, U., Lammers, R, Kharitonenkov, A, Imyanitov, E., Ullrich, A., and Bohmer, F. D., 1995 Association ofSH2 Domain Protein Tyrosine Phosphatases with the Epiderrnal Growth Factor Receptor in Human Tumor Cells X Biol. Chem. 270, 21277‑
21284.
e Vecchi, M., Baulida, J., and Carpenter, G, 1996. Selective Cleavage ofthe Heregulin
Chapter 4
e Vogel, W., Lammers, R., Huang, J., and Ullrich, A., 1993 Activation of a
phosphotyrosine phosphatase by tyrosine phosphorylation. Sbience 259, 1611‑1614.
e Yarden Y., Sliwkowski M. X., 2001. Untangling the ErbB signaling netwotk, Alicrt. Rev.
MoL (lellBioL 2 127‑137.
'
e Yart, A., Laffargue, M., Mayeux, P., Chretien, S., Peres, C., Tonks, N., Roche, S., Payrastre, B., Chap, H., and Raynal, P., 2001 A Critical Role fbr Phosphoinositide 3‑
Kinase Upstream of Gabl and SHP2 in the Activation of Ras and Mitogen‑activated Protein Kinases by Epidermal (lrowth Factor. X Biol. Chem. 276, 8856‑8864.
e Yu, C. F., Liu, Z. X., and Cantley, L. G, 2002 ERK Negative!y Regulates the Epidermal (lrowth Factor‑mediated lnteraction of Gabl and the Phosphatidylinositol 3‑Kinase X BioL Chem. 277 19382‑･19388.
'
e Zhang, S. Q., Tsiaras, W. G, Araki, T., Wen, G., Mmichiello, L., Klein, R., and Neel, B.
G. 2002 Receptor‑Specific Regulation of Phosphatidylinosito1 3'‑Kinase Activation by the Protein Tyrosine Phosphatase Shp2. MoL CellBioL 22, 4062‑4072.
107
CHAPTER 5
3襯〃2αワ。ηdCoη01〃5∫oη5
enapter 5
5. SmmY AND CONCLUSIONS
This dissertation has addressed the identification of a novel FSH‑upregulated local factor, NRGI, and its signaling mechanism underlying activation of germ cell proliferation in newt
(CIynops,pp2rzhognstei;) testis.
ln the first part bfthe study, local factors secreted from somatic cells upon FSH treatment were screened by using microarray analysis and neuregulinl (NRGI) was identified as a novel FSH‑upregulated clone. cDNAs encoding two different clones were isolated from newt testis.
The deduced amino acid sequences oftwo clones were 75% and 94% identical to .)VZenopus leavis immunoglobulin (Ig)‑type and cysteine‑rich domain (CRD)‑type NRGI, respectively, which had distinct sequences in their N‑terminal region but identical in their epidemial growth factor (EGF)‑like domain. mRNA expression of the two different clones was funher analyzed in different sperrnatogenic stages and FSH‑responsiveness in different cell types by semi‑
quantitative and quantitative PCR analyses. It was shown that both clones were highly expressed at spermatogonial stage than at spermatocyte stage and in vitro FSH treatment increased newt Ig‑
NRGI (nlg‑NRGI) mRNA expression markedly in somatic cells, vvhereas newt CRD‑NRGI
(nCRD‑NRGI) mRNA was only slightly increased by FSH. To elucidate the function of newtNRGI (nNRGI), recombinant protein from the EGF‑like domain of nNRGI (nNRGI‑EGF)
known to mediate receptor signaling in marnmals and amphibians was produced and added into the various culture systems. nNRGI‑EGF promoted spermatogonial proliferation in organ culture, in which nNRGI is not allowed to act on germ cells directly due to the existence of blood‑testis barrier fbrmed by Sertoli cells. ln re‑aggregate cultures, in which blood‑testis banier was disrupted, nNRGI induced proliferation of spermatogonia either with or without somatic cells. In addition, treatment ofthe cultures with the antibody against nNRGI caused remarkable suppression of spermatogonial proliferation activated by FSH, indicating a pivotal role of nNRGI in promoting spemiatogonial proliferation by both direct effect on spermatogonia andindirect effect via somatic cells in newt testes.
109
Chapter 5
ln the second part ofthe study, to identify the receptors responsible fbr the ]NRGI‑induced spermatogonial proliferation in newt testis, several inhibitors fbr each ErbB receptor family member were added in both organ and re‑aggregate culture. The data revealed the inhibitors fbr ErbB2 or ErbB4 markedly suppressed the number of proliferated germ cells induced by nNRGI and FSH, indicating that both ErbB2 and ErbB4 are activated by nNRGI. Expression studies of ErbB2 and ErbB4 in diffbrent spermatogenic stages and cell types by using immunoblotting revealed their expression in both somatic and gerrn cells at all the spermatogenic stages from early spemiatogonial to primary spermatocyte. Since ligand binding to ErbB receptors induces the formation of homo‑ or hetero‑dimers, vvhich leads to the activation of diflierent signaling pathways, such as phosphatidylinositol‑3 kinase (PBK) or mitogen‑activated protein kinase (MAPK), the signaling pathway ofErbB2 and ErbB4 receptors was further analyzed by using specific inhibitors in response to nNRGI stimuladon. The results showed PI3K inhibitor was more efficient than MAPK inhibitor to repress nNRGI‑induced spermatogonial proliferation.
Thus, nNRGI can promote spermatogonial proliferation by binding to ErbB4, which induces the fbrrnation of ErbB4ZErbB4 homo‑ or ErbB41ErbB2 hetero‑dimers, leading to the activation of PI3K pathway in newt testis.
ln the last part ofthe study, to further understand the mechanism of NRGIIErbB signaling in the proliferation of sperrnatogonia, the proteins or molecules interacting with ErbB2 or ErbB4
receptor were screened by using matrix assisted laser desorption‑time of fiight‑mass
spectrometry (MALDI‑TOF‑MS) or electron‑spray ionization (ESI). Spliceosome associated protein 155 (SAP 155/SF3Bi55), a component of the U2 small nuclear ribonucleoprotein, was identified as a protein interacting with ErbB4. A partial cDNA was isolated approximately 2.7‑kb in length encoding 930 amino acid residue homologous to mouse SAPI55. Comparison ofthe amino acid sequence of newt SAP155 with its homologues in the N‑terminal region and C‑
terminal region revealed that the N‑terminal region contains a cluster of TP‑dipeptide motifs and a domain containing RWDETP repeag while the C‑terminal region showed significant similarity to PR65 subunit of protein phosphatase 2A Immunoblotting in different spermatogenic stages and cell types showed that newt SAPI55 was expressed in gemi cells at all spermatogenic stages.
(]hupter 5
However, co‑immunopreciphation of SAPI55 with ErbB4 antibody as well as the reciprocal co‑
irnmunoprecipitation demonstrated their interaction only in primary spermatocyte stage,
suggesting that SAP155‑ErbB4 binding may be linked to the downregulation of the
spermatogonial proliferation in primary spermatocyte stage.
Reproduction is one of the most important phenomenons in development. Since impaired sperm production and function accounts fbr half the cases of infenility, improvement to our knowledge on the molecular basis ofspermatogenesis could lead to treatments for male fertility.
ln this aspect this dissertation provides a new inside in the field of reproductive biology that FSH induces the expression of nlg‑NRGI in Sertoli cells and recombinant nNRGI activates ErbB2 and ErbB4 receptors directly on sperrnatogonia as well as on somatic cells, which leads to the signaling trough PI3K pathway and ultimately promote spermatogonial proliferation. The findings in this dissertation may help to pave the way fbr understanding the mechanism of spermatogenesis and hopefu11y may help to develop some specific therapies to restore fenility in the future.
111