Discussion

114

with only the [G-T-P] cis-element pattern (At1g62300, At1g17420, At3g01830, At3g49120, At3g57010, At5g59320) did not respond to 3-D clinorotation.

The second cis-element pattern of [S-E-G-G-A-I] was identified in only WRKY46 and CML38 which I examined in this study. As I expected, exposure to 3-D clinorotation resulted in 80- to 100-fold higher expression of WRKY46 and CML38 than to normal gravity. The CML38 gene, which had similar cis-element patterns in its promoter region to those in the promoter of WRKY46 (Fig. 2-5A), was expressed at similar levels to WRKY46 in response to 3-D clinorotation (Fig. 2-5B). Under 3-D clinorotation, both WRKY46 and CML38 showed slightly different expression patterns, expression peak time points, and increased expression fold levels even though the two genes shared the two patterns of [M/T-G-T-P] and [S-E-G-G-A-I]. These differences could be due to different spacing between the two sets of cis-elements.

The [M/T-G-T-P] motif in the WRKY46 promoter occurs over a 420 base long stretch between -465 to -885, whereas CML38 has a narrower pattern of [M/T-G-T-P] over a 212 base long stretch between -236 to -448. In addition to the position of [M/T-G-T-P], the position of [S-E-G-G-A-I] in the WRKY46 promoter is not superimposed with that of G-T-P], but in the CML38 promoter, these two patterns are superimposed [M/T-G-T-P].

Fig. 2-6 shows the distribution of the 20 selected cis-elements among the 10 3-D clinorotation-responsive genes, CML38, and the six WRKY genes. Each symbol represents different cis-elements. In addition, 20 cis-elements in the promoter regions of 24 abiotic stress-inducible genes were also analyzed by the same method and are summarized in Table 2-3. I found a unique arrangement and orientation of four cis-elements in all genes that were highly expressed in response to 3-D clinorotation.

115

from Agilent 44 K microarray based on their 10-fold higher expression in response to 3-D clinorotation as compared to normal (1G) gravity. These 10 genes were highly expressed in response to 3-D clinorotation 3-week-old plants (Fig. 2-2). Nine of these ten genes, with the exception of WRKY46, were also induced by wounding and touch stresses. However, WRKY46 was induced only by 3-D clinorotation and did not respond to the abiotic stresses such as drought, touching, and wounding.

Babbick et al., (1) reported that WRKY46 showed a 16-fold increase in expression levels 20~25 min after treatment of plants on a random positioning machine (RPM) and WRKY46 expression decreased starting 30 min after treatment. I observed a similar increase (3-fold) in the expression of WRKY46 at 1 h after treatment but after a 96 h treatment, the expression levels of WRKY46 increased rapidly beginning 6 h after treatment and then peaked (over 80-fold) at 12 h after treatment.

These results highlight the necessity of long-term observations in 3-week-old plants to evaluate plant responses to microgravity stress (7). Babbick et al., (1) subjected callus cultures of Arabidopsis to 2-D clinorotation, a random positioning machine (RPM), or magnetic levitation for 30 min, and then performed microarray analysis of 12 transcription factors including genes from the WRKY, MADS-box, MYB, and AP2/EREBP families. They demonstrated gravity-induced stress-related signaling and transduction, and found that some of the genes involved in gravity-induced signaling cascades were also involved in other stress responses, principally those associated with plant-pathogen interactions. Thus, the TFs involved in gravity-specific signaling and transduction belong to various TF families. WRKY transcription factors are known as a unique TF to plants. The 74 WRKY TFs were assigned to eight families based on both the number of WRKY domains and the features of their zinc-finger-like motifs (16).

Many of these TFs have been found to play important roles in plant responses to biotic and abiotic stresses, including low Pi stress (17), pathogen infection and other defense-related stimuli (18, 19, 20, 21), and 3-D clinorotation (5). In this study, qRT-PCR analysis showed that WRKY33, WRKY40, and WRKY46 out of eight WRKY genes were expressed in response to 3-D clinorotation and WRKY46 is interestingly expressed under the 3-D clinorotation but not induced by other abiotic stresses.

116

Stress-inducible gene expression is regulated by a variety of transcription factors. Promoter regions of genes harbor cis-elements that function as binding sites for TFs. cis-elements determine the timing and location of transcriptional activity (10).

Therefore, an analysis of the cis-elements present in the promoters of responsive genes is important to understand the regulatory systems involved in stress-responsive gene expression. Marathe et al. (22) identified five cis-elements within the 1.1 kb promoter regions of a select group of disease-resistance related genes and unknown genes in Arabidopsis that are up-regulated in response to virus infection using microarray experiments. They also determined the cis-elements of 80 defense-responsive genes in the context of R gene-mediated defense against both viral and bacterial pathogens. Cis-element analysis of newly isolated genes can give some insight into the putative function of the genes involved in stress responses. However, these authors only reported the locations and numbers of a few selected cis-elements.

WRKY46, which is expressed at high levels in response to 3-D clinorotation, has the cis-element pattern of [M/T-G-T-P] that it shares with eight other genes (Fig.

2-4). However, WRKY6 and six other genes have a different cis-element pattern [G-T-P] from [M/T-G-T-[G-T-P] shown in WRKY46, and these WRKY6 and six other genes did not respond to 3-D clinorotation even though they have [G-T-P] on their promoters.

Based on the in silico analysis, the presence of [M/T] on [M/T-G-T-P] might be important than only [G-T-P].

Venter and Warnich (23) stated that in silico analysis of promoter complexity can enhance my understanding of gene expression in plants exposed to various physiological stresses. Characterization of highly conserved regulatory elements in promoters may help to elucidate the regulatory interactions between distinct cis-element and trans-factors in response to stress. Critical analysis of cis-element organization combined with in silico analysis might allow prediction of transcriptional control and more defined genetic engineering. Murphy et al., (24) reported that gene expression could be altered by moving a single operator site in a promoter closer to the TATA box. However, for multiple operator-containing promoters, they found that both the position and number of operator sites determined spatial and temporal gene

117

expression. In particular, focusing on cis-element rearrangement, an understanding of the numbers, spatial positions, and orientations of cis-elements in promoters could aid in the development of plant synthetic promoters. Few studies, however, have examined how modifications of promoter structures and the target design of cis-elements can refine the control of spatial and temporal gene expression, regulate multiple transgenes, and overcome drawbacks caused by homology-dependent gene silencing in plant cells (25). To control the gene expression of specific genes in plant cells, new design strategies for synthetic promoters involving multimers of cis-elements need to be analyzed and optimized. Therefore, in this study, I tried to determine the positioning, numbers, and combinations of cis-elements present in the promoters of 3-D clinorotation inducible genes as well as other abiotic stress-inducible genes. Recently Zou et al., (26) demonstrated that gene expression patterns under multiple stresses can predict by plant cis-regulatory elements (CREs) involved in stress response of A. thaliana. They also emphasized the presence, combination, copy number, and location of CREs were used to establish the cis-regulatory code of stress-responsive gene expression in A. thaliana to the control of stress-responsive gene transcription. They support my findings about two constellations of cis-elements which are important for controlling the gene expression to 3-D clinorotation in this study.

My study is the first to report the order and spatial positioning of certain groups of cis-elements that control gene expression in response to environmental stresses or developmental programs. Together, my results suggest that gene expression can potentially be regulated by the order and/or spatial positioning of certain groups of cis-elements in artificially designed promoters.

118

Fig. 2-1 Identification pipeline and two constellations of cis-elements under the 3-D clinorotation.

119

Fig. 2-2 Time-course monitoring of the expression patterns of 10 selected genes with high expression in 3-week-old Arabidopsis thaliana after 1 to 96 h of exposure to clinostat (black circles) or normal gravity (white circles). The expression patterns were determined via qRT-PCR analysis of the genes, and 18S rRNA was used as the internal control. The experiments were carried out in triplicate for each gene and the error bars represent the standard error of the mean. The expression levels relative to the value of the control at 1 h (1.0) were calculated using GraphPad Prism v.5 (X axis:

clinorotation treatment time, Y axis: transcript abundance in relative expression of mRNA).

120

Fig. 2-3 Time-course monitoring of the expression patterns of six selected WRKY genes with high expression in 3-week-old Arabidopsis thaliana after 1 to 96 h of exposure to clinostat (black circles) or normal gravity (white circles). The expression patterns were determined via qRT-PCR analysis of the genes, and 18S rRNA was used as the internal control. The experiments were carried out in triplicate for each gene and the error bars represent the standard error of the mean. The expression levels relative to the value of the control at 1 h (1.0) were calculated using GraphPad Prism v.5 (X axis: clinorotation treatment time, Y axis: transcript abundance in relative expression of mRNA).

121

Fig. 2-4 Cartoon diagram showing the location of the MYB1AT/TATABOX5, GT1CONSENSUS, TATABOX5, and POLASIG2 binding sites in the 1 kb promoters of 15 genes highly expressed in response to 3-D clinorotation, drought, touch, and/or wounding stresses. The qRT-PCR and microarray results for 1 h and 12 h are shown in the right column. The names of the cis-elements and symbols are as shown in below.

122

Fig. 2-5 A. Diagrammatic presentation of At2g46400 (WRKY46) and At1g76650 (CML38) genes that have similar cis-element patterns in the promoter region. B.

Relative expression of At1g76650 (CML38) in 3-week-old Arabidopsis thaliana exposed to 3-D clinorotation (a) or wound stress for 10 min (black bars) versus mock-treated controls (gray bars) (b). Wounding stress was applied for 10 min. The expression patterns were determined via qRT-PCR analysis of the genes, and 18S rRNA was used as the internal control. The experiments were carried out in triplicate for each gene and the error bars represent the standard error of the mean. The expression levels relative to the value of the control at 1 h (1.0) were calculated using GraphPad Prism v.5 (X axis: clinorotation treatment time, Y axis: transcript abundance in relative expression of mRNA). Statistically significant differences (P < 0.05) are denoted by asterisks.

123

Fig. 2-6 Cartoon diagram showing the general patterns of 20 cis-elements in 17 selected genes.

124

Table 2-1. Responses of 3-D clinorotation inducible genes to the three abiotic stresses of drought, touch, and wounding. Written in bold 6 genes were used as the positive controls for each stress, respectively. Statistically significant differences (P < 0.05) are denoted by asterisks. (This table was made with the assistance of Yongsang Choi.)

Stresses Genes 1 2 5 10 24 (hr)

Drought At5g26030 0.41±0.09 0.18±0.04 0.33±0.07 *8.88±0.31 0.10±0.04 At1g80840 0.96±0.22 0.36±0.10 0.09±0.06 0.34±0.05 4.05±0.65 At1g74930 0.21±0.07 0.03±0.01 0.06±0.07 1.72±0.65 0.04±0.02 At1g60190 0.11±0.03 0.02±0.07 0.02±0.00 0.04±0.000 2.31±0.21 At4g24570 0.33±0.15 0.03±0.02 0.21±0.07 1.85±0.849 0.03±0.02 At4g27657 0.19±0.12 0.04±0.04 0.05±0.02 0.06±0.02 0.71±0.13 At1g72920 0.96±0.14 0.19±0.04 0.19±0.07 4,10±1.28 0.06±0.02 At1g72930 0.34±0.14 0.02±0.01 0.10±0.05 0.07±0.05 0.83±0.17 At2g32200 0.44±0.29 0.13±0.01 0.11±0.05 2.06±1.21 0.02±0.014 At2g46400 0.11±0.07 0.30±0.02 0.04±0.02 0.12±0.03 0.60±0.28 At3g15670 1.19±0.15 1.14±0.23 0.9±0.15 *5.07±1.55 1.49±0.25 At5g66780 1.39±0.58 1.33±0.69 0.99±0.35 *7.34±1.69 0.99±0.4

Genes 10 20 30 60 120 (min)

Touch At5g26030 *5.16±0.07 *6.09±0.90 3.23±0.76 1.41±0.47 2.63±0.11 At1g80840 *9.80±1.32 *6.46±1.75 1.00±0.40 0.47±0.21 0.97±0.19 At1g74930 *6.41±0.92 1.70±0.17 0.30±0.12 0.18±0.06 0.19±0.01 At1g60190 *4.68±1.17 3.45±1.19 2.80±0.29 *4.57±1.20 *7.29±1.29 At4g24570 *6.64±0.59 2.45±0.43 0.23±0.14 0.05±0.03 0.17±0.01 At4g27657 *9.34±1.38 3.16±0.21 0.52±0.37 0.16±0.08 0.67±0.10 At1g72920 *4.99±0.25 1.21±0.18 0.23±0.10 0.18±0.08 0.68±0.11 At1g72930 *4.51±0.33 1.57±0.22 0.60±0.15 0.31±0.08 1.11±0.13 At2g32200 *6.33±0.87 4.40±0.95 0.84±0.22 0.44±0.31 2.18±0.61

At2g46400 0 0 0.05±0.07 0.05±0.07 0

At3g01830 *18.13±1.23 *38.26±5.74 *6.49±1.5 1.55±0.3 1.25±0.8

125

At1g17420 1.82±0.5 *15.58±3.47 *7.94±3.04 *7.08±3.14 *3.21±1.4

Genes 10 20 30 60 120 (min)

Wound At5g26030 1.50±0.62 3.29±0.16 2.24±0.36 1.04±0.30 1.31±0.57 At1g80840 3.99±1.05 *4.40±0.45 1.93±0.64 0.94±0.14 1.06±0.11 At1g74930 *6.64±1.80 3.13±0.84 1.11±0.16 0.32±0.09 0.19±0.07 At1g60190 2.77±0.44 4.19±0.15 1.93±0.90 1.56±0.71 2.81±0.49 At4g24570 2.09±0.09 1.71±0.13 0.95±0.21 0.17±0.02 0.13±0.01 At4g27657 *6.30±1.12 *7.60±0.06 3.19±0.92 0.62±0.13 0.45±0 At1g72920 1.67±0.21 1.15±0.34 0.25±0.11 0.08±0.02 0.63±0.08 At1g72930 0.96±0.03 0.58±0.09 0.82±0.03 0.19±0 0.89±0.11 At2g32200 3.09±0.11 4.60±0.40 2.58±0.30 1.57±0.08 2.30±0.45

At2g46400 0 0 0 0 0

At5g59820 *5.50±1.32 *4.35±1.25 1.02±0.24 1.07±0.18 1.08±0.15 At3g44260 *2.64±0.36 1.17±0.24 0.78±0.24 0.11±0.14 0.7±0.15

126

Table. 2-2 A list of 22 genes and DNA primer sequences used for qRT-PCR as well as the locus ID of the 22 genes that was obtained from the Arabidopsis genome database (TAIR). The number in parenthesis refers to the reference cited in this chapter.

Genes Sequences (5' - 3') Locus ID References FC-I (ferrochelatase-I) (27) F ACAGATTTCCCAGGTCATGC

At5g26030 Nagai et al. 2007 R CAGTCACAGAACGAGCTTGC

ora47 (28) F AAGCAAGCGATGAAGGAAGA

At1g74930 Pauwels et al. 2008 R CTCGGGAGTGTCGTAAGAGC

AtPUB19 (U-box domain-

containing protein) (29)

F ACTCGCGGTGAAGATATTGG

At1g60190 Wiborg et al. 2008 R GTGTAAAGCGACCCCATGAT

mitochondrial DIC (30) F TGGTTAAGGGAGAAGGCGTA

At4g24570 Palmieri et al. 2008 R TCCCTAGCCCATCATTCATC

unknown protein F AGTACACGACGGCTCTTGCT

At4g27657 none R GGAGGACAAGGCAGAGAGAA

putative TIR-NBS gene (31) F GGAGACGAGCATTGACCAGT

At1g72920 Tan et al. 2007 R ACTAGGTCCCTCCCATTGCT

TIR (31) F AGAACTGGTTCGAAGGAGCA

At1g72930 Tan et al. 2007 R CACCAAGAAGACGCAGCATA

unknown protein F TGCAGGAGCTTATCCTACGC

At2g32200 none R ATCCATCAGCAGCTTCACCT

WRKY40 (32) F GTGGAGGATCAGTCCGTGTT

At1g80840 Scarpeci et al. 2008 R TTCTTCTGTTTGCTGCAACG

WRKY46 (1) F CATCCTTAAGCGAAGCCTTG

At2g46400 Babbick et al. 2007 R TTCTCCAGCAGTGACCATCA

WRKY6 (32) F CAGTTCTCTGGTGGCTCTCC

At1g62300 Scarpeci et al. 2008 R GAAATAACGGCTGCAAGAGC

WRKY15 (33) F AACTCAAAGCCTCTCCACGA

At2g23320 Park et al. 2005 R TTCTTCGAGCAATGACAACG

WRKY25 (34) F TTCACCGACCTTCTTGGTTC

At2g30250 Zheng et al. 2007 R AGACCCGGTTCTCTCTGGAT

WRKY28 (16) F TACGAGGGTCAACACAACCA

At4g18170 Eulgem et al. 2000 R CATGTGCAAAGCTTCTTGGA

WRKY33 (5) F TTACGCCACAAACAGAGCAC

At2g38470 Martzivanou et al.

2006 R CCAAAAGGCCCGGTATTAGT

127

WRKY75 (35) F AGGCCGTCAAGAACAACAAG

At5g13080 Devaiah et al. 2007 R ACGACCACTTCTTGGTCCAC

putative LEA protein (36) F AAGGCCGGGAGCTACTTATC

At3g15670 Seki et al. (2002) R CAAGAATCCACCCGTCTTGT

unknown protein (36) F TCTGACGAAGAAGGGTTTGG

At5g66780 Seki et al. (2002) R GTGGGATTGTGTCTGGTTCC

CML40 (13) F TGAAGGCATCACACCAAAAA

At3g01830 Lee et al. (2005) R ATTGCATCATGGCCCTAAAC

LOX3 (13) F GCATGCTTGGAGCCATTTAT

At1g17420 Lee et al. (2005) R TCGATCACACCATCTGCACT

RHL41 (14) F ATCAAGTCGACGGTGGATGT

At5g59820 Walley et al. (2007) R CCTAAGGCTTGGAACGAATG

CCR4-associated factor 1- like protein (14)

F CGCGTGATGAGAGTGTTGTT

At3g44260 Walley et al. (2007) R ATCCGAACCAGCTTGATGAC

CML38 F TCACCAAAGAGGGAAGATTCAG

At1g76650 Walley et al. (2007) R CCCATCTCCGTCCGTATCA

18S rRNA (5) F GATGAGCCTGCGTAGTATTAG Martzivanou et al.

2006 R AGTCATTCCGAAGAACACTTGC

128

Table 2-3. The list of locus IDs of the 40 analyzed genes and the 20 cis-elements located in promoter regions.

Groups Genes

GT1CONSENSUS MYCCONSENSUSAT EECCRCAH1 MYB1AT POLASIG1 TATABOX5 ANAERO1CONSENSUS CARGCW8GAT POLASIG2 ACGTCBOX CTRMCAMV35S ELRECOREPCRP1 IBOX MARABOX1 NAPINMOTIFBN NRRBNEXTA RYREPEATGMGY2 SORLIP2AT SPHCOREZMC1 TATABOX1

At4g24570 5 1 1 1 3 1 1 3 1 0 0 0 0 0 0 0 0 0 0 0 At5g26030 5 2 1 1 2 5 1 3 0 0 0 0 0 0 0 0 0 0 0 0 At1g80840 5 6 1 1 2 1 4 0 1 0 2 1 1 1 1 1 1 0 1 0 At1g74930 6 3 2 1 1 1 3 0 1 0 0 0 0 0 0 0 0 0 0 0 At1g60190 2 4 1 2 3 2 1 2 2 0 0 0 0 0 0 0 0 0 0 0 At4g27657 7 4 2 2 0 3 1 3 1 0 0 0 0 0 0 0 0 0 0 0 At2g46400 4 1 1 1 5 2 1 3 0 1 0 1 1 0 0 0 0 1 0 1 At1g72920 5 4 0 2 3 2 0 2 2 0 0 0 0 0 0 0 0 0 0 0 At1g72930 5 6 2 2 1 3 1 1 1 0 0 0 0 0 0 0 0 0 0 0 At2g32200 3 3 1 0 2 0 0 3 1 0 0 0 0 0 0 0 0 0 0 0 At1g62300 8 4 1 0 6 3 2 5 0 0 0 0 0 0 0 0 0 0 0 0 At2g23320 6 4 0 1 4 0 0 0 1 0 0 0 0 0 0 0 0 0 0 0 At2g30250 3 6 0 1 1 1 1 1 0 0 0 0 3 0 0 0 0 0 0 0 At2g38470 1 5 0 2 3 0 1 2 1 0 0 0 0 0 0 0 0 1 0 0 At4g18170 10 2 1 2 1 3 1 2 1 0 1 0 0 0 0 0 0 0 0 0 At5g13080 5 4 0 1 2 0 0 0 0 1 0 0 0 0 0 0 1 1 0 0 At1g77120 8 4 0 3 2 0 0 0 2 0 0 0 0 0 0 0 0 1 0 0 At2g19900 2 5 2 1 3 0 0 1 0 0 0 0 1 1 0 0 0 0 0 0 At3g15670 5 6 1 1 1 0 0 3 0 0 0 0 0 0 0 0 0 0 0 0 AT3G49120 6 2 0 1 3 2 0 1 1 0 0 0 0 0 0 0 0 0 0 0 At3g57010 4 3 0 0 9 2 0 1 1 0 0 0 0 1 0 0 0 0 0 0 At5g59320 6 4 0 1 2 1 0 1 2 0 0 0 0 0 1 0 0 0 0 0 At5g66780 2 6 0 0 0 2 1 3 0 0 0 0 0 0 0 0 0 1 0 0 At1g17380 8 2 0 1 2 1 0 1 0 0 0 0 1 0 0 0 0 0 0 0 At1g17420 9 1 1 0 2 2 0 0 0 0 0 0 0 0 0 0 0 0 0 0 At2g24600 1 1 0 1 1 4 1 2 2 0 0 0 0 0 0 0 0 0 0 0 At2g42760 2 3 2 3 1 5 0 2 0 0 0 0 1 0 0 0 0 0 0 0 At3g01830 2 4 0 1 3 1 1 1 0 0 0 0 0 1 0 0 0 0 0 0 At3g08720 3 4 2 0 1 0 1 0 0 0 0 2 0 0 0 0 0 0 0 0 At4g29780 6 2 1 4 5 3 0 0 2 0 1 0 0 0 0 0 0 0 0 0 At5g05410 8 6 0 1 4 0 1 0 0 0 0 0 1 0 1 0 0 0 0 0 At1g27730 5 4 1 2 0 4 0 2 0 0 0 0 0 0 0 0 0 0 0 0 At1g73540 7 4 2 0 2 1 1 2 0 0 0 1 0 0 0 0 0 0 0 0 At1g76650 6 5 1 0 2 3 3 2 3 0 0 2 1 0 1 0 0 1 0 0 At2g44840 6 1 3 0 1 3 1 3 0 0 0 0 0 0 0 0 0 0 0 0 At3g44260 4 3 4 0 4 3 0 0 1 0 0 0 0 1 0 0 0 0 0 0 At3g46620 3 5 1 3 0 2 5 0 1 0 0 0 1 0 0 0 0 0 0 0 At3g61190 6 2 0 0 3 6 2 0 0 0 0 0 0 0 1 0 0 0 0 0 At5g59820 1 1 0 6 3 0 0 1 3 1 0 0 0 0 0 0 0 0 0 0 At5g62360 2 7 0 3 0 0 0 0 0 0 0 0 1 0 0 0 0 0 0 0

microgravitywrkydroughttouchwound

129