• 検索結果がありません。

Conclusion

ドキュメント内 東北大学機関リポジトリTOUR (ページ 57-96)

55

56

4 Comprehensive discussion

The response of A. thaliana ecotype Col-0 to a series of reassortant CMVs with different chimeric composition of two CMV strains of differing virulence, CMV(H) and CMV(Y), was that necrotic cell death developed only in virus-inoculated leaves of Col-0 infected with reassortant CMVs carrying CMV(H) RNA1; for example, CMV(HYY) as shown in Figure 2. The amount of CMV CP accumulated in CMV(HYY)-inoculated Col-0 leaves was similar to that in CMV(Y)-inoculated Col-0 leaves showing necrotic cell death was similar to that in CMV(Y)-inoculated Col-0 leaves, which are susceptible to CMV(Y) but show no cell death (Figure 2 and Figure 4). Furthermore, both CMV(HYY) and CMV(Y) spread systemically in Col-0 plants (Figure 6). Therefore, the necrotic cell death developing on leaves inoculated with reassortant CMVs carrying CMV(H) RNA1 does not confer resistance to CMV, which is different from what happens with HR cell death.

When assessing host responses to reassortant CMVs, it was first considered that necrotic cell death might be an artifact caused by a heterogenous interaction between the CMV(H) 1a protein and other proteins encoded on CMV(Y) RNA2 and CMV(Y) RNA3, because CMV(H) itself did not induce necrotic cell death in virus-inoculated Col-0 leaves (Figure 2A). However, the results from single amino acid substitutions in the CMV(Y) 1a protein, were found to determine the occurrence of necrotic cell death, indicating that the mechanism of this necrotic cell death is likely to be more complex than that considered initially. The development of necrotic cell death in virus-inoculated leaves of Col-0 was induced by co-infection of CMV(Y) RNA2 and CMV(Y) RNA3 with a CMV(Y) RNA1 encoding a 1a protein carrying single amino acid substitutions around its MET domain, and this cell death did not affect virus multiplication. So far, it has been reported that a single amino acid substitution from R to C at amino acid position 461 of CMV 1a protein produces an HR-like necrotic phenotype in virus-inoculated leaves of Nicotiana tabacum, although the substitution

57

Figure 21. Cell death induced in three virus and plant interactions. Cell death induced in incompatible interactions of virus and plants was identified as HR cell death, which developed in the virus inoculated leaves and restricted the systemic spread of virus. On the other hand, cell death induced in compatible interactions of virus and plants was identified as lethal systemic necrosis. Some recent studies suggesting systemic necrosis could be induced through a delayed HR in the virus inoculated plants is accumulating. Intriguingly, in this study, a necrotic cell death was observed in 1a protein mutant CMV inoculated Col-0 leaves. The 1a protein mutant CMV could systemically infect the plant and induce systemic stunting and yellowing symptoms but not systemic necrotic cell death. The global gene expression of leaves showing necrotic cell death greatly differs from those showing HR cell death. And the necrotic cell death was also identified as a common response in various ecotypes of A. thaliana. Therefore, the necrotic cell death induced in the 1a protein mutant CMV inoculated Col-0 leaves was a different type of cell death from HR cell death and systemic necrosis.

Figure 4-1 The induction of cell death in plant-virus interactions

58

does not affect virus multiplication [37]. Modeling of 1a protein has also demonstrated structural changes in the 1a protein caused by amino acid substitutions at position 461, which is relevant to an HR-like cell death phenotype [38]. Also, the HEL domain of the 1a protein of CMV isolate P0 [CMV(P0)] determines Cmr1-conferred resistance to CMV in pepper in a gene-for-gene manner [39]. These findings suggests that necrotic cell death (rather than being an artifact of a heterogenous interaction between the CMV(H) 1a protein and other proteins encoded on CMV(Y) RNA2 or CMV(Y) RNA3), may be induced by single amino acid mutation occurring naturally in CMV(Y) 1a protein during CMV(Y) multiplication in host cells.

In the experiments reported here, single amino acid substitutions at residues 29, 49, 54, 298, 299, or 310 in both the N- and C-terminal regions around the MET domain (amino acid 72 to 290) of the 1a protein (Figures 12 and 19) independently induced necrotic cell death in Col-0. Although mutation affecting the amino acid composition of the MET domain of 1a protein disrupt capping activities and virus replication [40], single amino acid substitutions at the N- and C-terminal regions around the MET domain did not affect virus multiplication and systemic spread in the host plants (Figure 20). It is also observed that the N-terminal region of the hinge located between the MET and HEL domains of the 1a protein appears to self-interact to form homodimers in a yeast two-hybrid system [41]. Thus, change in the degree of self-interaction or conformational modification of the homodimer structure of the 1a protein (which could resulted from single amino acid substitutions around its MET domain) might be associated with the induction of necrotic cell death in Col-0 leaves in response to CMV(Y) carrying single amino acid substitutions around the MET domain. Further study is necessary to elucidate the mechanisms by which necrotic cell death is induced by single amino acid substitutions around the MET domain. However, the results reported here suggest that necrotic cell death can occur without preventing infection of virus and is not caused by the stress of infection of virus but by specific interactions between the virus and its host plant.

59

In this study, the induction of necrotic cell death was confirmed among 92 ecotypes of A. thaliana in response to the infection of CMV(HYY), Stw-0 and Mt-0 abolished the induction of necrotic cell death. There may be underlying plant factors that confer the induction of necrotic cell death through its interaction with CMV(HYY), and they might be inactivated by mutation or disrupted by deletion in Stw-0 and Mt-0.

Recently, evidence is accumulating that systemic necrosis (which was considered as a symptom of compatible interaction between a virus and its host plant) may result from the induction of HR cell death with incomplete restriction of virus spread in host plants [21,36,42-45] (Figure 21). The lethal systemic cell death might have been caused by delayed HR cell death and escape of the virus to distant tissues, thereby leading to runaway cell death, because virus-induced lethal systemic necrosis is correlated with activation of defense-related signaling pathways (e.g., MAP-kinase cascade) which are associated with incompatible interactions between host plants carrying R genes and avirulent strains of virus [22]. However, necrotic cell death in CMV(HYY)-inoculated Col-0 leaves did not cause lethal necrosis, even though the virus particles did systemically spread to noninoculated upper leaves of Col-0 plants (Figure 6B). This finding indicates that the necrotic cell death that developed in CMV(HYY)-inoculated Col-0 leaves might be a symptom of a compatible interaction between A. thaliana Col-0 and CMV, but not a resistance response to CMV or lethal systemic cell death caused by delayed HR cell death. Furthermore, such phenomenon that different symptoms developing in inoculated and non-inoculated leaves could also be observed in HRT carrying Arabidopsis and turnip crinkle virus (TCV) interactions, tobacco cultivar Taiyan8 and CMV interaction, and potato and potato virus Y (PVY) interactions [33-36]. And in studies of potato and PVY interactions, the expression pattern of miRNA/mRNA were altered differently in the inoculated and non-inoculated upper leaves and the metabolic responses to PVY infection were less intensive in non-inoculated leaves compared to inoculated leaves [36]. Therefore, more researches were needed to

60

analyze the disease development in Col-0 and CMV(HYY) interaction through detailly study of the symptom development in both inoculated and non-inoculated leaves with biochemical and genetical methods.

Indeed, comparative RNA-Seq analysis of CMV(HYY)-inoculated Col-0 leaves and CMV(Y)-inoculated Col::RCY1 leaves, indicated that the numbers of up- or downregulated genes in CMV(Y)-inoculated Col::RCY1 leaves showing HR cell death were much greater than those in CMV(HYY)-inoculated Col-0 leaves showing necrotic cell death.

Many genes whose expression was specifically upregulated in CMV(Y)-inoculated Col::RCY1 leaves encoded several SA signaling-dependent defense-related proteins, which might be associated with RCY1-conferred resistance to CMV through restricting virus spread around primary infection sites (Figure 7, 8). However, several JA signaling-related genes (which seem not to affect virus multiplication) were upregulated in CMV(HYY)-inoculated Col-0 leaves (Figure 7, 10). Therefore, the necrotic cell death observed in CMV(HYY)-inoculated Col-0 leaves might not be contributing to CMV resistance. Moreover, only a limited number of overlapping DEGs (which might be relevant to necrotic cell death and HR cell death) was identified (Figure 7). Further investigation of the function of gene products associated with the induction of cell death should reveal the significance of cell death in the interactions between viruses and host plants.

Cell death in virus-infected plants is a critical event for virus survival, because virus multiplication depends on host cell metabolism. However, the role of cell death in virus–host plant interactions remains poorly understood. The finding of necrotic cell death in A. thaliana, which is determined by CMV-encoded 1a protein but unrelated to CMV resistance and HR cell death (including lethal systemic cell death), presents a new pathosystem to investigate the role of necrotic cell death in virus–host plant interactions.

61

5 Literature

1. Jones, J.D.G.; Dangl, J.L. The plant immune system. Nature 2006, 444, 323-329.

2. Palukaitis, P.; García Arenal, F. Cucumber Mosaic Virus; APS Press: St. Paul, MN, USA, 2018.

3. NG, J.C.K.; L.Perry, K. Transmission of plant viruses by aphid vectors. Mol. Plant Pathol. 2004, 5, 505-511.

4. Christie, R.G.; Edwardson, J.R. Light microscopic techniques for detection of plant virus inclusions. Plant Dis. 1986, 70, 273-279.

5. Huysmans, M.; Lema A, S.; Coll, N.S.; Nowack, M.K. Dying two deaths — programmed cell death regulation in development and disease. Curr. Opin.

Plant Biol. 2017, 35, 37-44.

6. Buchanan, B.B.; Gruissem, W.; Jones, R.L. Biochemistry And Molecular Biology of Plants; Wiley: Hoboken, New Jersey, US, 2015.

7. Jones, A.M. Programmed cell death in development and defense. Plant Physiol.

2001, 125, 94.

8. Fomicheva, A.S.; Tuzhikov, A.I.; Beloshistov, R.E.; Trusova, S.V.; Galiullina, R.A.;

Mochalova, L.V.; Chichkova, N.V.; Vartapetian, A.B. Programmed cell death in plants. Biochemistry (Moscow) 2012, 77, 1452-1464.

9. Morgan, P.W.; Drew, M.C. Plant cell death and cell differentiation. In Plant Cell Death Processes, Noodén, L.D., Ed. Academic Press: San Diego, CA, US, 2004;

pp. 19-36.

10. Barlow, P.W. Cell death: an integral part of plant development. Growth regulators in plant senescence 1982, 8, 27-45.

11. Dickman, M.B.; de Figueiredo, P. Death be not proud—cell death control in plant fungal interactions. PLoS Path. 2013, 9, e1003542.

12. Sekine, K.; Kawakami, S.; Hase, S.; Kubota, M.; Ichinose, Y.; Shah, J.; Kang, H.G.;

Klessig, D.F.; Takahashi, H. High level expression of a virus resistance gene, RCY1, confers extreme resistance to cucumber mosaic virus in Arabidopsis thaliana.

Mol. Plant-Microbe Interact. 2008, 21, 1398-1407.

13. Takahashi, H.; Goto, N.; Ehara, Y. Hypersensitive response in cucumber mosaic virus‐inoculated Arabidopsis thaliana. Plant J. 1994, 6, 369-377.

14. Bendahmane, A.; Kanyuka, K.; Baulcombe, D.C. The Rx gene from potato controls separate virus resistance and cell death responses. Plant Cell 1999, 11, 781-791.

15. Al Daoude, A.; de Torres Zabala, M.; Ko, J.H.; Grant, M. RIN13 is a positive regulator of the plant disease resistance protein RPM1. Plant Cell 2005, 17, 1016-1028.

16. Yu, I.; Parker, J.; Bent, A.F. Gene-for-gene disease resistance without the hypersensitive response in Arabidopsis dnd1 mutant. Proc. Natl. Acad. Sci. USA 1998, 95, 7819-7824.

62

17. Clough, S.J.; Fengler, K.A.; Yu, I.c.; Lippok, B.; Smith, R.K.; Bent, A.F. The Arabidopsis dnd1 “defense, no death” gene encodes a mutated cyclic nucleotide-gated ion channel. Proc. Natl. Acad. Sci. USA 2000, 97, 9323-9328.

18. Baulcombe, D.; Gilbert, J.; Goulden, M.; Kohm, B.; Cruz, S.S. Molecular biology of resistance to potato virus X in potato. Biochem. Soc. Symp. 1994, 60, 207-218.

19. Hammond Kosack, K.E.; Silverman, P.; Raskin, I.; Jones, J. Race-specific elicitors of cladosporium fulvum Induce changes in cell morphology and the synthesis of ethylene and salicylic acid in tomato plants carrying the corresponding of disease resistance gene. Plant Physiol. 1996, 110, 1381-1394.

20. Morel, J.B.; Dangl, J.L. The hypersensitive response and the induction of cell death in plants. Cell Death Differ. 1997, 4, 671.

21. Komatsu, K.; Hashimoto, M.; Ozeki, J.; Yamaji, Y.; Maejima, K.; Senshu, H.;

Himeno, M.; Okano, Y.; Kagiwada, S.; Namba, S. Viral-induced systemic necrosis in plants involves both programmed cell death and the inhibition of viral multiplication, which are regulated by independent pathways. Mol. Plant-Microbe Interact. 2010, 23, 283-293.

22. Inaba, J.; Kim, B.M.; Shimura, H.; Masuta, C. Virus-induced necrosis is a consequence of direct protein-protein interaction between a viral RNA-silencing suppressor and a host catalase. Plant Physiol. 2011, 156, 2026-2036.

23. Sambrook, J.; Russel, D. In Molecular Cloning: a Laboratory Manual Cold Spring Harbor Laboratory Press: New York, NY, 2001.

24. Tomaru, K.; Hidaka, Z. Strains of cucumber mosaic virus isolated from tobacco plants. II. A mild strain. Bull. Hatano Tob. Exp. Stn. 1960, 46, 143-149.

25. Takahashi, H.; Ehara, Y. Severe chlorotic spot symptoms in cucumber mosaic virus strain Y-infected tobaccos are induced by a combination of the virus coat protein gene and two host recessive genes. Mol. Plant-Microbe Interact. 1993, 6, 182-189.

26. Bradford, M.M. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal.

Biochem. 1976, 72, 248-254.

27. Koenig, R. Indirect ELISA methods for the broad specificity detection of plant viruses. J. Gen. Virol. 1981, 55, 53-62.

28. Bowling, S.A.; Guo, A.; Cao, H.; Gordon, A.S.; Klessig, D.F.; Dong, X. A mutation in Arabidopsis that leads to constitutive expression of systemic acquired resistance. Plant Cell 1994, 6, 1845-1857.

29. Bolger, A.M.; Lohse, M.; Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 2014, 30, 2114-2120.

30. Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.;

Chaisson, M.; Gingeras, T.R. STAR: ultrafast universal RNA-seq aligner.

Bioinformatics 2013, 29, 15-21.

31. Love, M.; Huber, W.; Anders, S. Moderated estimation of fold change and

63

dispersion for RNA-seq data with DESeq2. Genome Biol. 2014, 15, 550.

32. Benjamini, Y.; Hochberg, Y. Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society.

Series B (Methodological) 1995, 57, 289-300.

33. Chen, H.; Boutros, P.C. VennDiagram: a package for the generation of highly-customizable Venn and Euler diagrams in R. BMC Bioinformatics 2011, 12, 35.

34. Zhou, Y.; Zhou, B.; Pache, L.; Chang, M.; Khodabakhshi, A.H.; Tanaseichuk, O.;

Benner, C.; Chanda, S.K. Metascape provides a biologist-oriented resource for the analysis of systems-level datasets. Nat. Commun. 2019, 10, 1523.

35. Yu, G.; Wang, L.G.; Han, Y.; He, Q.Y. ClusterProfiler: an R package for comparing biological themes among gene clusters. OMICS: J. Integrative Biol. 2012, 16, 284-287.

36. Hashimoto, M.; Komatsu, K.; Iwai, R.; Keima, T.; Maejima, K.; Shiraishi, T.;

Ishikawa, K.; Yoshida, T.; Kitazawa, Y.; Okano, Y. Cell death triggered by a putative amphipathic helix of radish mosaic virus helicase protein is tightly correlated with host membrane modification. Mol. Plant-Microbe Interact.

2015, 28, 675-688.

37. Diveki, Z.; Salanki, K.; Balazs, E. The necrotic pathotype of the cucumber mosaic virus (CMV) ns strain is solely determined by amino acid 461 of the 1a protein.

Mol. Plant-Microbe Interact. 2004, 17, 837-845.

38. Salánki, K.; Gellért, Á.; Náray Szabó, G.; Balázs, E. Modeling-based characterization of the elicitor function of amino acid 461 of cucumber mosaic virus 1a protein in the hypersensitive response. Virology 2007, 358, 109-118.

39. Kang, W.H.; Seo, J.K.; Chung, B.N.; Kim, K.H.; Kang, B.C. Helicase domain encoded by cucumber mosaic virus RNA1 determines systemic infection of Cmr1 in pepper. PLoS One 2012, 7, e43136.

40. Seo, J.K.; Kwon, S.J.; Choi, H.S.; Kim, K.H. Evidence for alternate states of cucumber mosaic virus replicase assembly in positive-and negative-strand RNA synthesis. Virology 2009, 383, 248-260.

41. O’Reilly, E.K.; Wang, Z.; French, R.; Kao, C.C. Interactions between the structural domains of the RNA replication proteins of plant-infecting RNA viruses. J. Virol.

1998, 72, 7160-7169.

42. Fujisaki, K.; Hagihara, F.; Azukawa, Y.; Kaido, M.; Okuno, T.; Mise, K.

Identification and characterization of the SSB1 locus involved in symptom development by spring beauty latent virus infection in Arabidopsis thaliana.

Mol. Plant-Microbe Interact. 2004, 17, 967-975.

43. Chen, H.; Adam Arsovski, A.; Yu, K.; Wang, A. Deep sequencing leads to the identification of eukaryotic translation initiation factor 5A as a key element in Rsv1-mediated lethal systemic hypersensitive response to soybean mosaic virus infection in soybean. Mol. Plant Pathol. 2017, 18, 391-404.

44. Kim, B.M.; Suehiro, N.; Natsuaki, T.; Inukai, T.; Masuta, C. The P3 protein of turnip mosaic virus can alone induce hypersensitive response-like cell death in

64

Arabidopsis thaliana carrying TuNI. Mol. Plant-Microbe Interact. 2010, 23, 144-152.

45. Hajimorad, M.; Eggenberger, A.; Hill, J. Loss and gain of elicitor function of soybean mosaic virus G7 provoking Rsv1-mediated lethal systemic hypersensitive response maps to P3. J. Virol. 2005, 79, 1215-1222.

65

6 Supplementary tables

Table S1. Primer list for in vitro transcribed cDNA to RNA1, RNA2 and RNA3 of CMV(H) in this study Primer name Primer sequence (5'-3')1)

CMV.RNA1-5'.F GGCCAGTGCCAAGCTTTAATACGACTCACTATAGTTTTATTTACAAGAGCGTACGGTTCAATYC CMV.RNA1-3'.R ACCGCGGTGGCGGCCGCTGGTCTCCTTTTGGARGCCCCCACGA

CMV.RNA2-5'.F GCCAGCTCTAGAGGATCCAATTAATACGACTCACTATAGTTATTTACAAGAGCGTACGGTTCAACCC CMV.RNA2-3'.R ACCGCGGTGGCGGCCGCTGGTCTCCTTTTGGAGGCCCCACGA

CMV.RNA3-5'.F GCCAGCTCTAGAGGATCCAATTAATACGACTCACTATAGTAATCTAACCACCTGTGTGTGTGTGTGT CMV.RNA3-3'.R ACCGCGGTGGCGGCCGCTGGTCTCCTTTTGGAGGCCCCCACGA

1) T7 RNA promoter sequence was shown by bold letter and restriction sites of HindIII, BamHI and NotI were underlined, respectively.

Table 2. Primer list for in vitro transcribed cDNA to RNA1, RNA2 and RNA3 of CMV(H) in this study

66

Table S2. Primer list for construction of chimeric cDNA to CMV RNA1 in this study.

Name of primer Sequence of primer (5'-3')1)

CMV RNA1-5`.FOR GGCCAGTGCCAAGCTTTAATACGACTCACTATAGTTTTATTTACAAGAGCGTACGGTTCAATYC

CMV-Y-HEL.FOR CTATTGACAATGTAAAGCTCTCCATCAGACT

CMV-Ho7.2c-HEL.FOR TTACATTGTCAATAGTGAGTGTGTGATATGCA

Frag4-RNA1(1120-1145).FOR CTATGTTGGTCTAAAGATTCCCGCGT

Frag-B.FOR CCGCTTGTGTGAAACTCTCGA

Frag-C.FOR GTTCATGATTGGGAGAATATAAAATCTTTTCT

CMV-Ho7.2c-NO-HEL.REV CTATTGACAATGAAAAGCTCTCCATCAGACT

CMV RNA1-3`.REV ACCGCGGTGGCGGCCGCTGGTCTCCTTTTGGARGCCCCCACGA

CMV-Y-NO-HEL.REV CTATTGACAATGTAAAGCTCTCCATCAGACT

Frag3-RNA1(1134-1101).REV TTTAGACCAACATAGTCTTTAATAGAGGGGAACC

Frag-A.REV GTTTCACACAAGCGGAGGGC

Frag-B.REV CTCCCAATCATGAACATAAGACATAGTAGA

1) T7 RNA promoter sequence was shown by bold letter and restriction sites of HindIII and NotI were underlined.

Table 3. Primer list for construction of chimeric cDNA to CMV RNA1 in this study.

67

Table 4. Template RNA and Primers used for the first RT-PCR for construction of chimeric cDNA to CMV RNA1 in this study.

TableS3. Template RNA and Primers used for the first RT-PCR for construction of chimeric cDNA to CMV RNA1 in this study.

Transcription vector for RNA1

First RT-PCR

First RT-PCR product Template RNA Name of forward Name of reverse

HY H1-NON-HEL CMV(H) RNA1 CMV RNA1-5`.FOR

CMV-Ho7.2c-NO-Y1-HEL CMV(Y) RNA1 CMV-Y-HEL.FOR CMV RNA1-3`.REV

YH Y1-NON-HEL CMV(Y) RNA1 CMV RNA1-5`.FOR CMV-Y-NO-HEL.REV

H1-HEL CMV(H) RNA1 CMV-Ho7.2c-HEL.FOR CMV RNA1-3`.REV

Y-H/343 Frag3 CMV(H) RNA1 CMV RNA1-5`.FOR

Frag3-RNA1(1134-Frag4 CMV(Y) RNA1 Frag4-RNA1(1120- CMV RNA1-3`.REV

Y-H/344~682 Frag10 CMV(Y) RNA1 CMV RNA1-5`.FOR

Frag3-RNA1(1134-Frag6 CMV(HY) RNA1 Frag4-RNA1(1120- CMV RNA1-3`.REV

Y-H/71 FragH(a) CMV(H) RNA1 CMV RNA1-5`.FOR Frag-A.REV

FragY(b) CMV(Y) RNA1 Frag-B.FOR Frag-B.REV

FragYY(c) CMV(Y) RNA1 Frag-C.FOR CMV RNA1-3`.REV

Y-H/72~343 FragY(a) CMV(Y) RNA1 CMV RNA1-5`.FOR Frag-A.REV

FragH(b) CMV(H) RNA1 Frag-B.FOR Frag-B.REV

FragHY(c) CMV(F94) Frag-C.FOR CMV RNA1-3`.REV

Y-H/290 FragH(a) CMV(H) RNA1 CMV RNA1-5`.FOR Frag-A.REV

FragH(b) CMV(H) RNA1 Frag-B.FOR Frag-B.REV

FragYY(c) CMV(Y) RNA1 Frag-C.FOR CMV RNA1-3`.REV

Y-H/72~290 FragY(a) CMV(Y) RNA1 CMV RNA1-5`.FOR Frag-A.REV

FragH(b) CMV(H) RNA1 Frag-B.FOR Frag-B.REV

FragYY(c) CMV(Y) RNA1 Frag-C.FOR CMV RNA1-3`.REV

Y-H/71+291~343 FragH(a) CMV(H) RNA1 CMV RNA1-5`.FOR Frag-A.REV

FragY(b) CMV(Y) RNA1 Frag-B.FOR Frag-B.REV

FragHY(c) CMV(H-MV) RNA1 Frag-C.FOR CMV RNA1-3`.REV

Y-H/291~343 FragY(a) CMV(Y) RNA1 CMV RNA1-5`.FOR Frag-A.REV

FragY(b) CMV(Y) RNA1 Frag-B.FOR Frag-B.REV

FragHY(c) CMV(H-MV) RNA1 Frag-C.FOR CMV RNA1-3`.REV

68

Table S4. Primer list for nucleotide substitution in cDNA to CMV RNA1 in this study.

Transcription vector for RNA1

Plasmid DNA

template Name of primer Sequence of primer (5'-3')1)

T29A pCY1-T7 CMV-Y[29'T-A].FOR CGCCCTCGTTGATAAGGCAGCTCATGAGCAGCT

CMV-Y[29'T-A].REV AGCTGCTCATGAGCTGCCTTATCAACGAGGGCG

I49V pCY1-T7 CMV-Y[49'I-V].FOR GGGGCCGTAAGGTCTACGTTCGAAACGTTTTGGGTGT

CMV-Y[49'I-V].REV ACACCCAAAACGTTTCGAACGTAGACCTTACGGCCCC

G54S pCY1-T7 CMV-Y[54'G-S].FOR ACATCCGAAACGTTTTGAGCGTAAAGGATTCCGAGGT

CMV-Y[54'G-S].REV ACCTCGGAATCCTTTACGCTCAAAACGTTTCGGATGT

R298Q pCY1-T7 CMV-Y[298'R-Q].FOR ACCAGACTTATTCGTACCAAGGGATGACTTACGGTAT

CMV-Y[298.R-Q].REV ATACCGTAAGTCATCCCTTGGTACGAATAAGTCTGGT

G299R pCY1-T7 CMV-Y[299'G-R].FOR CAGACTTATTCGTACCGAAGGATGACTTACGGTATAG

CMV-Y[299'G-R].REV CTATACCGTAAGTCATCCTTCGGTACGAATAAGTCTG

H310N pCY1-T7 CMV-Y[310'H-N].FOR AGAACGCTGCGTTATTAATGCTGGTATCATGACGT

CMV-Y[310'H-N].REV ACGTCATGATACCAGCATTAATAACGCAGCGTTCT 1) The nucleotide, which was substituted in primer sequence, was shown by bold character.

Table 5. Primer list for nucleotide substitution in cDNA to CMV RNA1 in this study.

69

Table S5. The 149 up-regulated genes in CMV(Y)-inoculated Col::RCY1 leaves showing HR cell deathTable 6 The 149 up-regulated genes in CMV(Y)-inoculated Col::RCY1 leaves showing HR cell death Class Gene ID log2FC.HR-cell

death

padj.HR-cell death

log2FC.Necrotic cell death

padj.Necrotic cell

death Description

ClassI AT1G30420 2.202 3.150E-10 1.487 3.603E-02 multidrug resistance-associated protein 12 (ABCC11)

ClassI AT4G37640 2.040 2.870E-20 1.280 4.952E-03 calcium ATPase 2 (ACA2)

ClassI AT1G09932 4.926 1.883E-03 1.875 3.761E-02 Phosphoglycerate mutase family protein

ClassI AT1G22410 2.425 4.840E-23 1.709 1.436E-04 Class-II DAHP synthetase family protein

ClassI AT1G35710 2.225 1.220E-28 1.582 8.949E-03 kinase family with leucine-rich repeat domain-containing protein ClassI AT1G60730 3.052 4.670E-16 1.820 3.260E-02 NAD(P)-linked oxidoreductase superfamily protein

ClassI AT1G66880 2.763 2.580E-25 1.715 6.789E-03 Protein kinase superfamily protein

ClassI AT1G74360 3.292 4.840E-14 1.774 4.816E-02 Leucine-rich repeat protein kinase family protein

ClassI AT2G39210 2.392 3.590E-19 1.619 2.778E-02 Major facilitator superfamily protein

ClassI AT2G44290 2.540 6.030E-15 1.773 6.180E-03 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein

ClassI AT3G28540 3.372 4.710E-16 1.757 2.442E-02 P-loop containing nucleoside triphosphate hydrolases superfamily protein

ClassI AT4G39830 4.844 1.030E-15 1.628 3.541E-02 Cupredoxin superfamily protein

ClassI AT5G63680 2.225 3.650E-13 1.401 4.085E-02 Pyruvate kinase family protein

ClassI AT3G13790 2.738 1.280E-29 1.651 2.507E-02 Glycosyl hydrolases family 32 protein (ATBFRUCT1)

ClassI AT2G30490 2.284 2.490E-22 1.499 9.955E-03 cinnamate-4-hydroxylase (C4H)

ClassI AT1G76040 2.693 3.890E-16 1.599 6.045E-03 calcium-dependent protein kinase 29 (CPK29)

ClassI AT1G08450 3.636 2.730E-88 1.899 1.449E-04 calreticulin 3 (CRT3)

ClassI AT3G26210 2.850 5.170E-18 1.910 3.316E-02 cytochrome P450, family 71, subfamily B, polypeptide 23 (CYP71B23)

ClassI AT5G24530 3.962 4.140E-72 1.540 1.568E-02 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein (DMR6)

ClassI AT1G74710 3.706 3.340E-18 1.979 3.257E-03 ADC synthase superfamily protein (EDS16)

ClassI AT3G50480 2.813 6.110E-37 1.367 4.503E-02 homolog of RPW8 4 (HR4)

ClassI AT5G54160 2.631 2.430E-22 1.474 3.177E-03 O-methyltransferase 1 (OMT1)

ClassI AT3G52430 4.038 3.640E-34 1.628 1.461E-02 alpha/beta-Hydrolases superfamily protein (PAD4)

ClassI AT2G37040 2.333 1.210E-19 1.456 5.356E-03 PHE ammonia lyase 1 (PAL1)

70

ClassI AT2G31865 3.067 3.297E-04 1.543 4.637E-02 Poly (ADP-ribose) glycohydrolase 2 (PARG2)

ClassI AT3G54960 2.100 3.610E-09 1.693 6.789E-03 PDI-like 1-3 (PDIL1-3)

ClassI AT5G53370 2.053 1.420E-18 1.899 3.443E-03 pectin methylesterase PCR fragment F (PMEPCRF)

ClassI AT4G02380 3.713 4.361E-04 1.396 4.030E-02 senescence-associated gene 21 (SAG21)

ClassI AT2G30140 2.158 1.100E-08 1.968 1.647E-02 UDP-Glycosyltransferase superfamily protein (UGT87A2) ClassI AT1G33560 2.263 2.400E-08 0.764 4.852E-01 Disease resistance protein (CC-NBS-LRR class) family (ADR1)

ClassI AT5G20960 3.055 3.093E-03 1.417 2.124E-01 aldehyde oxidase 1 (AO1)

ClassI AT3G25780 2.139 7.090E-05 0.872 2.541E-01 allene oxide cyclase 3 (AOC3)

ClassI AT1G25220 2.288 2.080E-09 1.538 6.550E-02 anthranilate synthase beta subunit 1 (ASB1)

ClassI AT1G10340 3.027 1.510E-25 0.569 6.192E-01 Ankyrin repeat family protein

ClassI AT1G13340 3.345 2.087E-04 1.521 4.079E-01 Regulator of Vps4 activity in the MVB pathway protein

ClassI AT1G13470 4.824 1.030E-28 1.873 5.066E-01 hypothetical protein (DUF1262)

ClassI AT1G24145 3.494 1.980E-12 0.761 5.770E-01 transmembrane protein

ClassI AT1G51890 4.547 8.580E-06 1.588 5.002E-01 Leucine-rich repeat protein kinase family protein ClassI AT1G56120 2.972 1.560E-20 0.237 8.665E-01 Leucine-rich repeat transmembrane protein kinase ClassI AT1G61360 2.192 4.120E-07 0.343 7.050E-01 S-locus lectin protein kinase family protein

ClassI AT1G67360 2.134 2.935E-03 1.243 1.676E-01 Rubber elongation factor protein (REF)

ClassI AT1G67850 2.008 5.510E-09 0.903 3.459E-01 lysine ketoglutarate reductase trans-splicing protein (DUF707)

ClassI AT1G76960 3.851 1.160E-27 1.527 6.413E-02 transmembrane protein

ClassI AT2G04400 2.380 2.190E-13 1.082 1.699E-01 Aldolase-type TIM barrel family protein

ClassI AT2G18690 4.015 4.910E-08 1.625 3.098E-01 transmembrane protein

ClassI AT2G20142 2.993 7.200E-13 1.560 1.638E-01 Toll-Interleukin-Resistance (TIR) domain family protein ClassI AT2G26440 2.030 3.900E-07 1.159 2.074E-01 Plant invertase/pectin methylesterase inhibitor superfamily ClassI AT2G27660 2.897 4.330E-11 -0.691 6.536E-01 Cysteine/Histidine-rich C1 domain family protein

ClassI AT2G28400 2.082 4.850E-05 0.668 5.358E-01 senescence regulator (Protein of unknown function, DUF584)

ClassI AT3G01830 3.826 5.720E-11 0.191 9.140E-01 Calcium-binding EF-hand family protein

ClassI AT3G15356 2.129 2.050E-05 0.949 3.231E-01 Legume lectin family protein

ClassI AT3G16530 2.909 2.250E-07 -0.207 8.967E-01 Legume lectin family protein

71

ClassI AT3G29240 2.414 1.060E-36 0.855 2.579E-01 PPR containing protein (DUF179)

ClassI AT3G47090 2.500 1.100E-05 1.172 1.648E-01 Leucine-rich repeat protein kinase family protein

ClassI AT3G51450 2.838 8.680E-06 1.229 1.094E-01 Calcium-dependent phosphotriesterase superfamily protein

ClassI AT4G03450 2.934 3.300E-13 1.785 4.968E-01 Ankyrin repeat family protein

ClassI AT4G14370 2.045 1.650E-05 0.685 4.563E-01 Disease resistance protein (TIR-NBS-LRR class) family

ClassI AT4G17720 2.158 6.820E-09 0.946 2.616E-01 RNA-binding (RRM/RBD/RNP motifs) family protein

ClassI AT4G25900 2.016 5.000E-10 1.271 6.463E-02 Galactose mutarotase-like superfamily protein

ClassI AT4G29520 2.077 6.600E-05 1.388 1.404E-01 nucleophosmin

ClassI AT4G38540 2.467 3.395E-02 1.340 3.126E-01 FAD/NAD(P)-binding oxidoreductase family protein ClassI AT4G39670 3.101 2.360E-09 1.372 2.365E-01 Glycolipid transfer protein (GLTP) family protein

ClassI AT5G03350 2.073 1.430E-17 0.697 3.988E-01 Legume lectin family protein

ClassI AT5G10760 4.820 1.950E-95 1.876 2.816E-01 Eukaryotic aspartyl protease family protein

ClassI AT5G18470 4.048 3.690E-32 1.737 3.695E-01 Curculin-like (mannose-binding) lectin family protein

ClassI AT5G24210 2.156 4.360E-16 0.435 5.640E-01 alpha/beta-Hydrolases superfamily protein

ClassI AT5G44568 2.993 1.610E-27 0.528 6.173E-01 transmembrane protein

ClassI AT5G48540 2.714 2.400E-05 0.445 7.302E-01 receptor-like protein kinase-related family protein

ClassI AT5G48657 2.467 4.730E-07 1.276 3.294E-01 defense protein-like protein

ClassI AT5G52760 4.499 7.000E-24 1.068 7.607E-01 Copper transport protein family

ClassI AT5G52810 3.057 1.840E-15 1.276 1.532E-01 NAD(P)-binding Rossmann-fold superfamily protein

ClassI AT5G58620 2.174 5.650E-09 1.574 6.670E-02 zinc finger (CCCH-type) family protein

ClassI AT5G64120 2.907 3.000E-16 1.052 3.167E-01 Peroxidase superfamily protein

ClassI AT5G67340 3.602 9.760E-20 1.076 2.624E-01 ARM repeat superfamily protein

ClassI AT5G20230 3.162 3.490E-40 1.078 4.306E-01 blue-copper-binding protein (BCB)

ClassI AT3G50930 2.379 3.114E-03 0.803 1.942E-01 cytochrome BC1 synthesi (BCS1)

ClassI AT3G57240 4.785 3.420E-31 1.562 5.919E-01 beta-1,3-glucanase 3 (BG3)

ClassI AT1G72680 2.017 9.160E-06 1.591 9.549E-02 cinnamyl-alcohol dehydrogenase (CAD1)

ClassI AT5G26920 3.465 1.530E-36 0.587 4.254E-01 Cam-binding protein 60-like G (CBP60G)

ClassI AT4G01010 2.288 4.280E-08 1.104 2.801E-01 cyclic nucleotide-gated channel 13 (CNGC13)

72

ClassI AT4G23190 2.390 1.070E-02 0.231 8.065E-01 cysteine-rich RLK (RECEPTOR-like protein kinase) 11 (CRK11) ClassI AT4G23210 3.090 2.650E-17 1.014 3.901E-01 cysteine-rich RLK (RECEPTOR-like protein kinase) 13 (CRK13)

ClassI AT4G23220 2.364 2.860E-17 0.203 8.604E-01 cysteine-rich RECEPTOR-like kinase (CRK14)

ClassI AT3G45860 2.962 3.620E-27 1.168 9.171E-02 cysteine-rich RLK (RECEPTOR-like protein kinase) 4 (CRK4) ClassI AT2G29720 2.343 6.290E-08 0.246 8.366E-01 FAD/NAD(P)-binding oxidoreductase family protein (CTF2B) ClassI AT5G45380 2.659 4.450E-14 0.562 6.869E-01 urea-proton symporter DEGRADATION OF UREA 3 (DUR3) (DUR3)

ClassI AT4G33050 2.114 1.760E-19 0.778 3.376E-01 calmodulin-binding family protein (EDA39)

ClassI AT3G48090 2.025 9.410E-16 0.821 1.362E-01 alpha/beta-Hydrolases superfamily protein (EDS1) ClassI AT5G47220 2.069 1.280E-06 0.437 6.254E-01 ethylene responsive element binding factor 2 (ERF2)

ClassI AT4G36220 2.475 2.660E-23 0.603 3.822E-01 ferulic acid 5-hydroxylase 1 (FAH1)

ClassI AT5G25250 2.658 4.010E-05 0.737 7.581E-01 SPFH/Band 7/PHB domain-containing membrane-associated protein family (FLOT1)

ClassI AT2G19190 4.564 1.180E-06 1.965 4.587E-01 FLG22-induced receptor-like kinase 1 (FRK1)

ClassI AT2G29120 2.441 1.420E-12 1.440 8.889E-02 glutamate receptor 2.7 (GLR2.7)

ClassI AT4G02520 2.983 4.610E-32 1.581 3.450E-01 glutathione S-transferase PHI 2 (GSTF2)

ClassI AT1G02930 3.589 1.517E-02 1.408 4.802E-01 glutathione S-transferase 6 (GSTF6)

ClassI AT4G36990 4.052 1.750E-18 1.130 2.691E-01 heat shock factor 4 (HSF4)

ClassI AT1G51800 4.195 6.440E-07 1.544 1.070E-01 Leucine-rich repeat protein kinase family protein (IOS1) ClassI AT1G64400 2.306 1.200E-11 0.655 3.879E-01 AMP-dependent synthetase and ligase family protein (LACS3)

ClassI AT5G01540 3.289 3.557E-03 1.064 2.074E-01 lectin receptor kinase a4.1 (LECRKA4.1)

ClassI AT5G40780 2.812 4.770E-22 1.411 9.222E-02 lysine histidine transporter 1 (LHT1)

ClassI AT2G33580 2.214 6.520E-06 0.281 8.081E-01 Protein kinase superfamily protein (LYK5)

ClassI AT5G45800 2.218 8.790E-08 0.713 4.495E-01 Leucine-rich repeat protein kinase family protein (MEE62)

ClassI AT3G23250 3.360 2.110E-12 -0.065 9.721E-01 myb domain protein 15 (MYB15)

ClassI AT2G17040 2.490 2.280E-13 0.688 3.460E-01 NAC domain containing protein 36 (NAC036)

ClassI AT2G29990 2.145 5.880E-07 1.497 6.584E-02 alternative NAD(P)H dehydrogenase 2 (NDA2)

ClassI AT4G05020 2.353 6.799E-03 1.123 2.040E-01 NAD(P)H dehydrogenase B2 (NDB2)

ClassI AT1G14880 5.802 2.500E-31 1.370 6.257E-01 PLANT CADMIUM RESISTANCE 1 (PCR1)

73

ClassI AT1G14870 3.490 7.140E-04 1.692 1.469E-01 PLANT CADMIUM RESISTANCE 2 (PCR2)

ClassI AT3G04720 3.817 1.420E-18 1.623 4.563E-01 pathogenesis-related 4 (PR4)

ClassI AT5G46050 3.618 1.810E-21 1.402 1.982E-01 peptide transporter 3 (PTR3)

ClassI AT1G65790 2.113 1.400E-10 0.439 6.759E-01 receptor kinase 1 (RK1)

ClassI AT1G73805 2.841 1.330E-27 0.964 2.830E-01 Calmodulin binding protein-like protein (SARD1)

ClassI AT2G47130 2.853 5.750E-11 1.293 6.790E-01 NAD(P)-binding Rossmann-fold superfamily protein (SDR3) ClassI AT2G31880 2.525 1.870E-54 0.528 3.044E-01 Leucine-rich repeat protein kinase family protein (SOBIR1)

ClassI AT2G37970 2.328 4.934E-04 1.509 5.664E-02 SOUL heme-binding family protein (SOUL-1)

ClassI AT5G01820 2.441 1.233E-03 0.056 9.671E-01 serine/threonine protein kinase 1 (SR1)

ClassI AT4G22590 2.134 3.850E-07 0.537 5.210E-01 Haloacid dehalogenase-like hydrolase (HAD) superfamily protein (TPPG)

ClassI AT5G17990 2.283 7.730E-16 1.209 6.798E-02 tryptophan biosynthesis 1 (TRP1)

ClassI AT3G54640 3.029 2.020E-16 1.577 6.798E-02 tryptophan synthase alpha chain (TSA1)

ClassI AT4G20110 3.320 4.940E-22 1.587 1.094E-01 VACUOLAR SORTING RECEPTOR 7 (VSR7)

ClassI AT5G50200 2.640 8.300E-12 1.639 1.293E-01 nitrate transmembrane transporter (WR3)

ClassI AT2G46400 3.579 5.750E-25 1.301 8.497E-02 WRKY DNA-binding protein 46 (WRKY46)

ClassI AT4G23810 4.132 1.500E-23 0.100 9.194E-01 WRKY family transcription factor (WRKY53)

ClassI AT4G14365 2.803 5.250E-21 0.822 3.445E-01 hypothetical protein (XBAT34)

ClassI AT2G38860 2.985 1.839E-04 1.312 2.119E-01 Class I glutamine amidotransferase-like superfamily protein (YLS5)

ClassI AT1G59590 2.065 2.025E-04 -0.065 9.604E-01 ZCF37 (ZCF37)

ClassI AT1G33960 8.532 1.560E-20 2.505 3.623E-01 P-loop containing nucleoside triphosphate hydrolases superfamily protein (AIG1)

ClassI AT4G11890 3.892 1.680E-09 2.036 2.357E-01 Protein kinase superfamily protein (ARCK1)

ClassI AT2G45220 5.222 2.440E-38 4.047 2.992E-01 Plant invertase/pectin methylesterase inhibitor superfamily

ClassI AT3G47480 4.485 1.782E-02 2.794 2.585E-01 Calcium-binding EF-hand family protein

ClassI AT4G00700 6.462 1.310E-21 3.293 1.816E-01 C2 calcium/lipid-binding plant phosphoribosyltransferase family protein

ClassI AT5G39670 4.292 9.980E-20 2.118 4.065E-01 Calcium-binding EF-hand family protein

ClassI AT3G51860 2.967 3.026E-02 3.063 1.930E-01 cation exchanger 3 (CAX3)

ClassI AT2G43570 7.333 1.170E-41 3.680 1.522E-01 Chitinase (CHI)

ClassI AT4G04500 5.087 7.232E-04 3.399 1.220E-01 cysteine-rich RLK (RECEPTOR-like protein kinase) 37 (CRK37)

74

ClassI AT4G23140 6.765 2.690E-32 2.779 2.275E-01 cysteine-rich RLK (RECEPTOR-like protein kinase) 6 (CRK6)

ClassI AT2G30750 3.202 2.559E-02 3.152 2.350E-01 cytochrome P450 family 71 polypeptide (CYP71A12)

ClassI AT2G30770 8.336 4.310E-11 2.721 1.575E-01 cytochrome P450 family 71 polypeptide (CYP71A13)

ClassI AT1G61800 6.363 1.400E-05 3.703 1.259E-01 glucose-6-phosphate/phosphate translocator 2 (GPT2)

ClassI AT2G29460 4.734 3.610E-09 2.897 2.954E-01 glutathione S-transferase tau 4 (GSTU4)

ClassI AT1G51760 2.633 4.620E-18 2.544 6.657E-02 peptidase M20/M25/M40 family protein (IAR3)

ClassI AT3G26830 5.789 4.625E-04 2.821 3.395E-01 Cytochrome P450 superfamily protein (PAD3)

ClassI AT3G26840 2.292 4.977E-02 2.503 3.885E-01 Esterase/lipase/thioesterase family protein (PES2)

ClassI AT2G14610 9.949 6.920E-13 3.821 1.857E-01 pathogenesis-related protein 1 (PR1)

ClassI AT2G32680 6.445 1.980E-25 3.080 1.761E-01 receptor like protein 23 (RLP23)

ClassI AT3G25010 7.955 2.850E-12 3.349 7.467E-02 receptor like protein 41 (RLP41)

ClassI AT2G24850 7.103 2.380E-47 2.212 3.927E-01 tyrosine aminotransferase 3 (TAT3)

ClassI AT2G43510 2.953 6.020E-10 2.474 1.555E-01 trypsin inhibitor protein 1 (TI1)

ClassI AT1G61120 6.492 9.570E-08 2.726 2.005E-01 terpene synthase 04 (TPS04)

75

Table 7 The 35 up-regulated genes common to CMV(HYY)-inoculated Col-0 leaves showing necrotic cell death and CMV(Y)-inoculated Col-0::RCY1 leaves showing HR cell death Table S6. The 35 up-regulated genes common to CMV(HYY)-inoculated Col-0 leaves showing necrotic cell death and CMV(Y)-inoculated Col-0::RCY1 leaves showing HR cell death

Class Gene ID

log2FC.HR-cell death

padj.HR-cell death

log2FC.Necrotic cell death

padj.Necrotic

cell death Description

ClassII AT1G04990 2.134 2.430E-06 2.019 6.349E-03 Zinc finger C-x8-C-x5-C-x3-H type family protein (AT1G04990) ClassII AT1G17745 3.466 1.571E-03 2.562 5.984E-04 D-3-phosphoglycerate dehydrogenase (PGDH)

ClassII AT1G21240 7.872 1.990E-17 2.552 5.831E-03 wall associated kinase 3 (WAK3)

ClassII AT1G22400 2.968 5.540E-14 2.461 2.487E-02 UDP-Glycosyltransferase superfamily protein (UGT85A1) ClassII AT1G26390 9.091 4.980E-16 4.586 4.463E-02 FAD-binding Berberine family protein

ClassII AT1G30900 3.893 4.040E-31 2.449 9.045E-04 VACUOLAR SORTING RECEPTOR 6 (VSR6)

ClassII AT1G32940 2.226 7.300E-10 2.820 2.206E-04 Subtilase family protein (SBT3.5)

ClassII AT1G45145 3.372 1.450E-09 2.215 2.206E-04 thioredoxin H-type 5 (TRX5)

ClassII AT1G55210 2.518 1.430E-11 2.963 2.520E-07 Disease resistance-responsive (dirigent-like protein) family protein ClassII AT1G75040 7.615 3.240E-44 4.292 3.443E-03 pathogenesis-related protein 5 (PR5)

ClassII AT1G76970 2.463 9.750E-16 2.050 6.349E-03 Target of Myb protein 1

ClassII AT1G77510 2.317 2.900E-15 2.164 1.840E-05 PDI-like 1-2 (PDIL1-2)

ClassII AT2G29350 4.918 1.083E-03 4.429 9.535E-03 senescence-associated gene 13 (SAG13) ClassII AT2G30550 3.197 1.620E-28 2.767 6.160E-07 alpha/beta-Hydrolases superfamily protein ClassII AT2G47800 2.897 1.210E-06 3.391 7.930E-06 multidrug resistance-associated protein 4 (ABCC4) ClassII AT3G01420 7.995 5.904E-04 8.354 3.443E-03 Peroxidase superfamily protein (DOX1)

ClassII AT3G11010 3.266 3.360E-39 2.601 5.595E-04 receptor like protein 34 (RLP34)

ClassII AT3G22600 3.338 2.390E-20 4.663 2.889E-02 Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein

ClassII AT3G25882 3.611 1.300E-14 2.077 3.260E-02 NIM1-interacting 2 (NIMIN-2)

ClassII AT3G44720 2.603 3.220E-15 2.038 2.280E-03 arogenate dehydratase 4 (ADT4)

ClassII AT3G49120 3.728 6.740E-11 3.177 7.150E-07 peroxidase CB (PRXCB)

ClassII AT3G55970 4.509 3.130E-06 3.784 2.570E-05 jasmonate-regulated gene 21 (JRG21)

ClassII AT3G57260 9.985 2.580E-38 4.162 1.299E-02 beta-1,3-glucanase 2 (BGL2)

ClassII AT3G60415 3.650 9.330E-31 2.941 2.778E-02 phosphoglycerate mutase family protein

ドキュメント内 東北大学機関リポジトリTOUR (ページ 57-96)

関連したドキュメント