High-affinity monoclonal IgA regulates gut microbiota and prevents colitis in mice
全文
(2) Supplementary Table 1 VH sequences of IgA hybridomas from wild-type mice. Clone. VH. DH. JH. No. of amino acid changes. W1. J558.22.112. DSP2.7. JH2. 17. W2. V165.1. DSP2.2. JH3. 7. W3. 3609N.2.77. DFL16.1. JH1. 2. W4. VH10.3.91. -. JH2. 16. W6. SM7.3.54. DFL16.1. JH2. 7. W7. J558.6. DST4-C57BL/6. JH4. 17. W11. VHQ52.a21.63. DSP2.9. JH2. 8. W24. J558.67.166. DST4.3. JH4. 7. W27. SM7.2.49. DFL16.1. JH2. 12. W28. Q52.2.4. DSP2.9. JH2. 9. W30. J558.18.108. DSP2.9. JH2. 12. W32. V165.1. DSP2.2. JH3. 6. W34. 36-60.1.46. DFL16.1. JH4. 6. W37. J558.9.99. DQ52-BALB/c. JH2. 8. W43. J558.5A. DSP2.7. JH2. 11. W45. 7183.20.37. DSP2.8. JH4. 1.
(3) Supplementary Table 2 The List of Bacteria Sharing EEHI Sequences in SHMT. Accumulibacter phosphatis UW-1 app:CAP2UW1_1498. Actinobacillus pleuropneumoniae L20 apl:APL_0211. Aeromonas hydrophila subsp. hydrophila ATCC 7966 aha:AHA_3336. Aggregatibacter aphrophilus NJ8700 aap:NT05HA_1325. Alcanivorax borkumensis SK2 abo:ABO_2176. Alicycliphilus denitrificans BC adn:ALIDE_1929. Baumannia cicadellinicola Hc (Homalodisca coagulata) bci:BCI_0004. Bibersteinia trehalosi USDA-ARS-USMARC-192 bto:WQG_12410. Burkholderia pseudomallei K96243 bps:BPSL2758. Cellvibrio japonicus Ueda107 cja:CJA_2703. Citrobacter koseri ATCC BAA-895 cko:CKO_00237. Colwellia psychrerythraea 34H; BAA-681 cps:CPS_0728. Dechlorosoma suillum PS dsu:DSUI_1265. Dickeya zeae Ech1591 dze:DD1591_1093. Enterobacter sakazakii ATCC BAA-894 esa:ESA_00711. Enterobacter sp. 638 ent:ENT638_3036. Enterobacteriaceae bacterium strain FGI 57 ebf:D782_1125. Erwinia carotovora SCRI1043 eca:ECA3250. Erwinia tasmaniensis Et1/99 eta:ETA_10130. Escherichia blattae DSM 4481 ebt:EBL_C10170. Escherichia coli K-12 MG1655 eco:B2551. Ferrimonas balearica DSM 9799 fbl:FBAL_0829. Finegoldia magna ATCC 29328 fma:FMG_0855. Gallibacterium anatis UMN179 gan:UMN179_00690. Haemophilus influenzae Rd KW20 hin:HI0889. Haemophilus somnus 129Pt hso:HS_1627. Hahella chejuensis KCTC 2396 hch:HCH_03860. Hahella chejuensis KCTC 2396 hch:HCH_05959. Hamiltonella defensa T5A hde:HDEF_0160. Kangiella koreensis DSM 16069 kko:KKOR_0469. Klebsiella pneumoniae ATCC 700721; MGH 78578 kpn:KPN_02876. Legionella pneumophila Philadelphia 1 lpn:LPG0725. Leptothrix cholodnii SP-6 lch:LCHO_2927. Mannheimia haemolytica USDA-ARS-USMARC-183 mhq:D650_6350. Mannheimia succiniciproducens MBEL55E msu:MS1295. Methylibium petroleiphilum PM1 mpt:MPE_A2938. Morganella morganii subsp. morganii KT mmk:MU9_1692. Nitrosococcus oceani ATCC 19707 noc:NOC_2027. Oceanimonas sp. GK1 oce:GU3_05745. Pantoea sp. At-9b pao:PAT9B_2954. Pasteurella multocida PM70 pmu:PM0225. Photobacterium profundum SS9 ppr:PBPRA0795. Photorhabdus luminescens TTO1 plu:PLU3291. Proteus mirabilis HI4320 pmr:PMI1867. Providencia stuartii MRSN 2154 psi:S70_03040. Pseudomonas aeruginosa PAO1 pae:PA4602. Rahnella sp. Y9602 rah:RAHAQ_1028. Ramlibacter tataouinensis TTB310 rta:RTA_15320. Raoultella ornithinolytica B6 ror:RORB6_00180. Rubrivivax gelatinosus IL144 rge:RGE_38960. Saccharophagus degradans 2-40 sde:SDE_0417. Salmonella typhimurium LT2; SGSC 1412; ATCC 700720 stm:STM2555. Serratia proteamaculans 568 spe:SPRO_3638. Shewanella oneidensis MR-1 son:SO_3471. Shigella flexneri 301 sfl:SF2598. Sodalis glossinidius morsitans sgl:SG1775. Taylorella equigenitalis MCE9 teq:TEQUI_0391. Teredinibacter turnerae T7901 ttu:TERTU_3707. Thioalkalivibrio sp. HL-EbGR7 tgr:TGR7_0615. Thioalkalivibrio sp. HL-EbGR7 tgr:TGR7_1557. Thioflavicoccus mobilis 8321 tmb:THIMO_0342. Tolumonas auensis DSM 9187 tau:TOLA_2527. Vibrio cholerae N16961 vch:VC0941. Vibrio fischeri ES114 vfi:VF_0695. Wigglesworthia glossinidia wbr:WGLP501. Xenorhabdus nematophila ATCC 19061 xne:XNC1_3292. Xenorhabdus nematophila ATCC 19061 xne:XNC1_4237. Yersinia pestis CO92 ype:YPO2907. gamma proteobacterium gpb:HDN1F_25330. Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150.
(4) Supplementary Table 3 qPCR primer sequences and target taxa inferred from RDP ProbeMatch. Bacterial group name in qPCR. Primer name. Primer sequence (5'-3'). Clostridium coccoides group Clostridium leptum group Bacteroides fragilis group. g-Ccoc477-F g-Ccoc895-R sg-Clept933-F sg-Clept1164-R g-Bfra148-F2 g-Bfra626-R g-Atopo292-F g-Atopo488-R g-Prevo-F g-Prevo-R g-Ecylin-1 g-Ecylin-2. AAATGACGGTACCTGACTAA CTTTGAGTTTCATTCTTGCGAA GCACAAGCAGTGGAGT CTTCCTCCGTTTTGTCAA AYAGCCTTTCGAAAGRAAGAT CCAGTATCAACTGCAATTTTA GGGTTGAGAGACCGACC CGGRGCTTCTTCTGCAGG CACRGTAAACGATGGATGCC GGTCGGGTTGCAGACC GTGAYGGTAKCTTACCAGA CTTGCGTGCATACTCCC. g-Lact(Rin)-1 g-Lact(Rin)-2. AGCAGTAGGGAATCTTCCA CACCGCTACACATGGAG. Atopobium group Prevotella. Eubacterium cylinderroides group Lactobacillus group. Bacterial group name in qPCR Clostridium coccoides group Clostridium leptum group Bacteroides fragilis group Atopobium group. Exact position inferred from the RDP 440-890. Target taxa inferred from RDP ProbeMatch. 900-1160. Runimococcaceae. 150-635. Bacteroides specific Coriobacteriaceae specific Prevotellaceae specific Erysipelo -trichaceae specific Bacilli specific. 290-490 800-1300 460-870. 340-690. Lachnospiraceae. Matched genus name in the RDP within one mismatch Eubacterium, Pseudobutyrivibrio, Anaerostipes, Butyrivibrio, Marvinbryantia, Robinsoniella, Shuttleworthia, Roseburia, Coprococcus, Acetitomaculum, Dorea, Clostridium XlVa, Lachnospiraceae_incertae_sedis, Hespellia, Lactonifactor, Blautia, Ruminococcus Gemmiger, Sporotomaculum, Acetanaerobacterium, Ethanoligenens, Butyricicoccus, Flavonifractor, Desulfotomaculum, Faecalibacterium, Anaerotruncus, Ruminococcus, Subdoligranulum, Anaerofilum, Papillibacter, Fastidiosipila. Atopobium, Collinsella, Olsenella, Coriobacterium, Cryptobacterium, Paraeggerthella, Eggerthella, Gordonibacter. Prevotella Eubacterium cylinderroides group Lactobacillus group. Solobacterium, Erysipelotrichaceae_incertae_sedis. Alicyclobacillus, Bacillus, Oceanobacillus, Streptohalobacillus, Ureibacillus, Planococcus, Facklamia, Nosocomiicoccus, Aerococcus, Granulicatella, Atopococcus, Isobaculum, Pisciglobus, Lactobacillus, Fructobacillus, Anaerobacillus, Halolactibacillus, Vulcanibacillus, Exiguobacterium, Macrococcus, Staphylococcus, Eremococcus, Globicatella, Atopostipes, Alloiococcus, Carnobacterium, Desemzia, Pediococcus, Paralactobacillus, Cerasibacillus, Virgibacillus, Thermobacillus, Planomicrobium, Salinicoccus, Jeotgalicoccus, Ignavigranum, Abiotrophia, Alkalibacterium, Marinilactibacillus, Trichococcus, Lacticigenium, Weissella, Leuconostoc.
(5) Supplementary Table 4 Bacterial Culture Condition. Bacterial species. Culture medium. Culture condition. Escherichia coli. LB broth. Aerobic. Staphylococcus lentus. LB broth. Aerobic. Enterococcus faecalis. LB broth. Aerobic. Pseudomonas fulva. LB broth. Aerobic. Lactobacillus murinus. LB broth. Aerobic. Enterohabdus mucosicola. LB broth. Anaerobic. Lactobacillus casei. MRS broth. Aerobic. Coprococcus eutactus. GAM broth + 1% Glucose. Anaerobic. Blautia coccoides. GAM broth + 1% Glucose. Anaerobic. Megamonas hypermegale. GAM broth + 1% Glucose. Anaerobic. Eubacterium rectale. GAM broth + 1% Glucose. Anaerobic. Bifidobacterium bifidum. GAM broth + 1% Glucose. Anaerobic. Prevotella melaninogenica. GAM broth + 1% Glucose. Anaerobic. Bacteroides vulgatus. GAM broth + 1% Glucose. Anaerobic. Megamonas funiformis. GAM broth + 1% Glucose. Anaerobic. Faecalibacterium prasnitzii. GAM broth + 1% Glucose + 1%. Anaerobic. CH3COONa Ruminococcus obeum. PYG broth. Anaerobic. Blautia producta. GAM broth + 1% Glucose. Anaerobic. Roseburia intestinalis. GAM broth + 1% Glucose. Anaerobic.
(6) Supplementary Table 5 Primer sequences for cloning of full-length glyA gene from different bacteria strains. base sequence (5'-3') Escherichia coli SHMT F. CCGCGGCCGCCCATGTTAAAGCGTGAAA. Escherichia coli SHMT R. AGAGCGGCCGCCTGCGTAAACCGGGTAAC. Pseudomonas fulva SHMT F. CCGCGGCCGCCATGTTCAGCCGTGATTTGA. Pseudomonas fulva SHMT R. AGAGCGGCCGCCGTTGCCGTAGACCGGCAG. Staphylococcus lentus SHMT F. CCGCGGCCGCCATGTCATTTATTAAAAAG. Staphylococcus lentus SHMT R. AGAGCGGCCGCCTTTGTTGTAAAGTGGGAA. Lactobacillus casei SHMT F. CCGCGGCCGCCCATGGATTTCATGGCACAA. Lactobacillus casei SHMT R. AGAGCGGCCGCCTGATAAGGGATGACGGGC. Blautia coccoides SHMT F. CCGCGGCCGCCATGTATTCATTGGAA. Blautia coccoides SHMT R. AGAGCGGCCGCCTGCATTCAGCGGATA. Human SHMT F. CCGCGGCCGCCCATGCTGTACTTCTCT. Human SHMT R. AGAGCGGCCGCCGAAGTCAGGCAGGCC. NotI recognition sites were underlined..
(7) Supplementary Table 6 The criteria of disease activity index in DSS-induced colitis. Occult/gross Score. Weight loss. Stool consistency. 0. None. Normal. Normal. 1. 1-5%. 2. 5-10%. Loose stools. Hemoccult +. 3. 10-20%. 4. >20%. Diarrhea. Gross bleeding. bleeding. The Disease Activity Index 22 is the combined scores of weight loss, stool consistency and bleeding divided by 3. Normal stools = well formed pellets, loose stools = pasty and semiformed stools which do not stick to the anus, diarrhea = liquid stools that stick to the anus..
(8) Supplementary Table 7 The criteria of disease activity index in colitis induced by adoptive transfer of CD4+CD45RBhigh T cells. Score. Histological change. 0. 0 was given when there were no changes observed.. 1. Minimal scattered mucosal inflammatory cell infiltrates, with or without minimal epithelial hyperplasia; grade.. 2. Mild scattered to diffuse inflammatory cell infiltrates, sometimes extending into the submucosa and associated with erosions, with minimal to mild epithelial hyperplasia and minimal to mild mucin depletion from goblet cells; grade.. 3. Mild to moderate inflammatory cell infiltrates that were sometimes transmural, often associated with ulceration, with moderate epithelial hyperplasia and mucin depletion; grade.. 4. Marked inflammatory cell infiltrates that were often transmural and associated with ulceration, with marked epithelial hyperplasia and mucin depletion; and grade.. 5. Marked transmural inflammation with severe ulceration and loss of intestinal glands..
(9) Figure S1. O.D. (405 nm). 4 3 2 1 0. 4 3 2 1 0. 4 3 2 1 0. Enterococcus faecalis. 50$ 50. 55$. 0.5$ 0.05$ 0.005$ 0.5 0.05. Lactobacillus murinus. 50$ 50. 55$. 0.5$ 0.05 0.05$ 0.5. 0.005$. Megamonas hypermegale. 50$ 5$ 1$ 5 50 4". 4 3" 3 2 2" 1 0 1". 50$ 50 0". 0.5$ 0.05$ 0.005$ 0.1$ 0.5 0.05. Blautia producta. 55$. 0.5$ 0.05 0.05$ 0.005$ 0.5. 4 3 2 1 0. Enterorhabdus mucosicola. 50$. 5$. 50 4 3 2 1 0. 4 3 2 1 0. 0.5$. 0.05$. 0.005$. 0.5 0.05. Bacteroides vulgatus. 50$ 50. 55$. 0.5$ 0.05 0.05$ 0.005$ 0.5. Prevotella melaninogenica. 50$. 50 4 3 2 1 0. 5. 5$ 0.01$. 5. 0.5$. 0.05$. 0.5 0.05. 0.005$ 0.001$. 0.0001$. Megamonas funiformis. 50$ 50. 55$. 0.5$ 0.05 0.05$ 0.005$ 0.5. Antibody concentration (µg/ml) W27. W34. W43. W2. Supplementary Figure 1 The relative binding abilities of monoclonal IgA clones derived from LP of wild-type mice ELISA assay using serially diluted monoclonal IgA antibodies was performed against eight different bacterial species. All data are representative from at least three independent experiments. O.D.: optical density..
(10) Figure S2. SHMT-P1.1-BSA (RQEEHIELIASENC-BSA) 4 W27. O.D. (405 nm). 3. 2. 1. *. #* 0 3.3. 1.0. 0.1. 0.01. Antibody concentration (µg/ml). 13 independent IgA from C57BL/6 wild type mice ( 13 clones from Figure1a) 1A) 6 independent IgA from a C57BL/6 AIDG23S mouse 12 independent IgA from a C57BL/6 wild type mouse immunized with ovalbumin 13 independent IgA from BALB/c wild type mouse. *. IgA$that$do$not$bind$to$SHMT5P1.15BSA. #. mIgA;$a$mouse$myeloma5derived$IgA. Supplementary Figure 2 The relative affinity of monoclonal IgA clones against SHMT-P1.1-BSA. ELISA assay using serially diluted monoclonal IgA antibodies was performed against SHMT-P1.1-BSA (2 µg/ml). All IgA samples were prepared as culture supernatants. All data are representative from two independent experiments. O.D.: optical density..
(11) b. CBB (reduced, heated) W27 W2. CBB (non-reduced) 1 2. 1 W27 precipitated by ammonium sulfate. (kDa) 460 268 238. (kDa) 115 87 60. 2 W27 purified by affinity column conjugated with SHMT P1-BSA. α chain. 47. 171. 35. 117. κ chain. 28. Lanes in S Fig. 3b. 21. Western blot: (non-reduced) anti-mouse J chain. d. W27. Lanes in S Fig. 3a. W2. a. (kDa) 198. Western blot: anti-mouse α chain (reduced, heated). c. 117. W27 in water W2 in water Day. 0. 7. 0. 87. 7. (kDa) 115 87 60 47. 60 47 35. Lanes in S Fig. 3d. 35. Lanes in S Fig. 3c. W27. 21. W2. Western blot: (non-reduced) anti-mouse κ chain. 28. (kDa) 460 268 238 171 117 71 55 41. Lanes in S Fig. 3d. Supplementary Figure 3 Quality of orally administered IgA antibodies and affinity-purified W27 antibody (a) W27 and W2 were prepared by ammonium sulfate precipitation. Prepared solution of W27 and W2 (10 µg each) were analyzed on SDS-PAGE gel under reduced condition with CBB staining. (b) W27 precipitated by ammonium sulfate and affinity-purified W27 were analyzed on SDS-PAGE gel under non-reduced condition with CBB staining. (c) W27 and W2 in drinking water (25 µg/ml in tap water) were sampled at preparation (day 0) and day 7. Samples were loaded on SDS-PAGE gel under reduced condition, transferred on a nitrocellulose membrane and detected by anti-mouse α chain antibody (SouthernBiotech). (d) One µg of W27 and W2 were loaded on SDS-PAGE gel in non-reduced condition, transferred on nitrocellulose membrane and detected by anti-mouse J chain antibody (M-159) (Santa Cruz Biotechnology) or anti-mouse κ chain antibody (κ chain specific) (SouthernBiotech). Arrowheads indicate IgA oligomers, and arrows indicate IgA monomers (b, d). All data are representative from at least two independent experiments..
(12) Figure S4 IgA (µg/100 mg content) BALB/c! C57BL/6! AID-/-! AID-/-! AID-/-! AID-/-! wild-type wild-type W27-treated! W27-treated! W2-treated! W2-treated! (the 5th day) (the 7th day) (the 5th day) (the 5th day) Feces. 396 + 251 19.2 + 11.1 (n=5) (n=2). Middle ! intestine. 2.1 + 1.1 (n=4). 1.7 + 1.4 (n=4). 0.6 + 0.5 (n=4). 1.8 + 0.5 (n=4). 172 (n=1). n.d.. 0.8 + 1.0 (n=4). n.d.. 0.5 + 0.2 (n=4). n.d.. 308 (n=1). n.d.. 1.8 + 2.8 (n=4). n.d.. 1.4 + 1.1 (n=4). n.d.. Cecum. 71 (n=1). n.d.. 3.2 + 2.7 (n=4). n.d.. 0.5 + 0.2 (n=4). n.d.. Colon. 70 (n=1). n.d.. 0.9 + 1.0 (n=4). n.d.. 1.4 + 1.1 (n=4). n.d.. Lower ! intestine. AID-/W27-treated Upper intestine. Middle intestine. BALB/c Wild-type. AID-/-. Colon. Lower intestine. Colon. Colon. Supplementary Figure 4 Orally administrated W27 IgA reached and localized in whole gut in AID-/- mice Gut solid contents from each segment were sampled without squeezing and weighed. Nine times volume of PBS was added to gut contents. Gut contents were dissolved homogeneously by vortexing or beads-smash. Supernatants were separated by centrifugation and were subjected to an ELISA assay to measure the level of IgA. The 7th day means that faeces were sampled at the 7th day after renewal of drinking water containing IgA. The 5th day means that mice were sacrificed on the 5th day after renewal of drinking water containing IgA. Samples were not taken from upper intestine, because there were no solid contents. All data are expressed as means + SD. n.d.: not determined. The localization of orally administered W27 was confirmed by immunohistochemistry. W27 (1 mg) was given to AID-/- mice using a gastric tube. After four hours, mice were sacrificed. Then each segment of intestine was snap frozen for immunohistochemistry. Sections were stained with rabbit anti-mouse IgA antibody (Rockland) followed by Alexa-flour 568 labeled anti-rabbit IgG antibody (ThermoFischer Scientific) and DAPI. Sections from untreated AID-/- mice did not produce any positive signals with anti-IgA antibodies. Scale bars, 200 µm. Data are representative from two independent experiments..
(13) Figure 5. gure 5a modified. Supplementary Figure 5. Supplementary Figuremodulated 5 W27 oral treatment gut microbial composition in AIDG23S mice W27 oral treatment modulated gut microbial composition in AIDG23S mice Faecal bacterial cell numbers of seven bacterial groups obtained by qPCR. Closed circles and squares Faecal bacterial cell numbers of seven bacterial groups obtained by qPCR. Closed circles and G23S G23S indicate samples samples taken before afterand treatment from AID mice (n=4), The samples were squares indicate takenand before after treatment from AID micerespectively. (n=4), respectively. All as medians range. < 0.05 vs. corresponding taken treatment. the data sameare asexpressed those in Fig. 4e. All +data are *p expressed as the medians ± range. sample *p < 0.05 vs.before the corresponding sample taken before treatment. Statistical analysis was performed by Mann-Whitney test..
(14) W2. W27. Human SHMT. 47 37. (kDa) 112 84 60 47. W2. (kDa) 115 87. 36. 60 47. Myc (kDa) 112 84 60. W43. Lactobacillus casei SHMT. 115 87 60. 36. W34. Blautia coccoides SHMT. (kDa) 293T. Western blot. (kDa) 112 84 60 47. Staphylococcus lentus SHMT. 21/. Pseudomonas fulva SHMT. NS1. Fig. 2c. 293T. Blautia coccoides. Bifidobacterium bifidum. Lactobacillus casei. Escherichia coli SHMT. W27. Pseudomonas fulva. (kDa) 112 84 60 47 36 28/. Staphylococcus lentus. Escherichia coli. DH5α. Fig. 2a. 37. Fig. 2d 2 (kDa). 21/ W2 50 µl. - +. 115 87 62 47 37. 115 87 62. SHMT-Myc. Endogenous SHMT SHMT-Myc Endogenous SHMT. 37. Western Western blot blot W27W27. SHMT-Myc Endogenous SHMT. 47 37. Figure 3. W43 50 µl. W34 40 µl. Fig. 2e. - +. - +. (kDa). (kDa). 115 87 62 47 37. 115 87 62 47 37. SHMT-Myc Endogenous SHMT. (kDa). 197 112 84 60 47 36 28/. Myc. (kDa) 197 112 84 60 47. JW2535. Myc. ME9062. JW2535. (kDa). ME9062. Lanes in Fig. 2b. Fig. 3e. (kDa). 115 87. 60 87. 60. 37 47. 37. 36. (kDa). 28/. 115. Lanes in Fig. 3e. Western blot W27. 115. 47. 21/. 1. E. coli SHMT. Western blot DH5α lysate SHMT-3×Myc. CBB. Supplementary Figure 6 Full size gels and blots shown in Figures 2 and 3.. W27. 47. W27. (kDa). 87 60 115. 37. 87 60 47 37. E.L.coli SHMT casei SHMT. Lanes in Fig. 2b. 293T. (kDa). (kDa). L.293T casei SHMT mut-EEHI. - +. casei E.L.coli SHMT. W27 5 µl. mut-EEHI mut-EHNI SHMT. Western blot DH5α lysate SHMT-3×Myc. L.E.casei SHMT coli SHMT. Fig. 2b. (kDa)115 115 87 87 60 60 47 47 37. mut-EHNI. CBB. (kDa) 112 84 60 47 Figure 36 28/. DH5α lysate E. coli SHMT DH5α lysate SHMT-P1-BSA E. coli SHMT SHMT-P2-BSA SHMT-P1-BSA SHMT-P3-BSA. 36. SHMT-P2-BSA SHMT-P3-BSA. 47.
(15)
図
関連したドキュメント
Shigeyuki MORITA Casson invariant and structure of the mapping class group.. .) homology cobordism invariants. Shigeyuki MORITA Casson invariant and structure of the mapping
Our bound does not prove that every Cayley graph is a ˇ Cerný Cayley graph, but it does work for certain Cayley graphs of cyclic groups, dihedral groups, sym- metric groups,
Moreover, in fashioning his theory of semisimple groups, Weyl drew on a host of ideas from such historically disparate areas as Frobe- nius’ theory of finite group characters,
The goal of the present paper is a description of the singularities of the Selberg zeta function in terms of the group cohomology of Γ with coefficients in certain infinite
In [4] Clark and Schneider studied the meet in the lattice of group topologies and developed a convenient method for finding a basis of open sets for the meet of a countable
When relativistic quantum mechanics and field the- ory emerged, the half-integer internal angular momentum was interpreted in terms of the complex special linear group SL(2, C ) as
Using a poset fiber theorem, it is proved that the order ideal of this poset generated by the Coxeter elements is homotopy Cohen–Macaulay.. This method results in a new proof
• For preplant application, to the extent possible, do not move treated soil out of the row or move untreated soil to the surface during planting, or weed control will be