Role of PrtM in osmoadaptation of Streptococcus mutans

Accepted Article

This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi:

10.1111/1574-6968.12477

This article is protected by copyright. All rights reserved.

Received Date : 04-Mar-2014 Revised Date : 16-May-2014 Accepted Date : 22-May-2014 Article type : Research Letter Editor : Robert Burne

Role of PrtM in osmoadaptation of Streptococcus mutans

Maiko Kunii

, Takafumi Arimoto

*, Tokuji Hasegawa

, Hirotaka Kuwata

, Takeshi Igarashi

1

Department of Oral Microbiology and Immunology, Showa University School of Dentistry, Tokyo,

Japan

2

Department of Conservative Dentistry, Division of Comprehensive Dentistry, Showa University

School of Dentistry, Tokyo, Japan

Running title: Role of S. mutans PrtM in osmoadaptation

Key words: oral streptococci, environmental stress, compatible solutes, dental caries, lipoprotein

Accepted Article

*Correspondence: Takafumi Arimoto, Department of Oral Microbiology and Immunology, Showa

University School of Dentistry, 1-5-8 Hatanodai, Shinagawa-ku, Tokyo 142-8555, Japan.

Tel: +81 3 3784 8166; Fax: +81 3 3784 4105; E-mail: [email protected]

This work is dedicated in fondest memory to Prof. Takeshi Igarashi, whose influence as a mentor will

be greatly missed, and without whom this work would not have been possible.

Abstract

Osmoadaptation may be an important trait for the pathogenicity of Streptococcus mutans. However,

how this organism adapts to changes in osmolality in the oral cavity remains unclear. In this study, we

showed that S. mutans utilizes K

for osmoadaptation, where protease maturation lipoprotein (PrtM)

plays an important role. Although growth of the wild-type strain was impaired in a hyperosmotic

medium (BHI containing 0.3 M NaCl) compared with that in an unmodified BHI, the prtM mutant

grew much more poorly in 0.3 M NaCl BHI. Comparison of growth behavior in the hyperosmotic

medium supplemented with different osmoprotectants revealed that only the addition of K

allowed

the bacteria to overcome the impairment of growth caused by the high osmolality. These results

suggest that K

is an important compatible solute for S. mutans. Moreover, K

-associated recovery of

growth was not observed for the prtM mutant, indicating that PrtM plays a critical role in the

utilization of K

. Quantitative reverse-transcriptase polymerase chain reaction analysis showed that

prtM was induced by osmotic stress, implying that prtM is an osmoresponsive gene. Taken together,

Accepted Article

these findings suggest that K

is an important compatible solute for S. mutans, and that the

osmoresponsive lipoprotein PrtM is involved in K

utilization, contributing to osmoadaptation of S.

mutans.

Introduction

Streptococcus mutans is one of the major pathogens associated with the initiation and progression of

human dental caries (Hamada & Slade, 1980). The human oral cavity is typically characterized by

fluctuating environmental stress, which includes changes in pH, oxygen, and osmolality (Hamada &

Slade, 1980). Osmolality affects bacterial bioenergetics and gene expression (Wood, 1999), and may

have significant consequences in terms of survival and virulence of microorganisms. However, the

mechanism of how S. mutans responds to high osmolality is poorly understood.

The physiology and genetics of bacterial responses to osmotic stress have been extensively

studied in several bacterial species, including Escherichia coli, Salmonella enterica serovar Typhi,

Bacillus subtilis, Listeria monocytogenes, and Staphylococcus aureus (Csonka, 1989, Whatmore, et

al., 1990, Graham & Wilkinson, 1992, Bayles & Wilkinson, 2000). The mechanisms by which these

bacteria adjust to an increase in the osmotic potential of their environment have been defined, and are

broadly similar (Measures, 1975, Ingraham, 1987, Kempf & Bremer, 1998). Bacteria generally

respond to osmotic upshifts in the following three overlapping phases: phase I, dehydration (loss of

some cell water); phase II, adjustment of the composition of cytoplasmic solvents and rehydration;

Accepted Article

and phase III, cellular remodeling (Wood, 1999). Initial dehydration leads to a rapid influx of K

as a

counter solute to maintain cytoplasmic turgor. Subsequently, compatible solutes, such as glycine

betaine, are accumulated and replace much of the intracellular K

(Ingraham, 1987, Whatmore, et al.,

1990, Whatmore & Reed, 1990, Kempf & Bremer, 1998). Choline, glycine betaine, and

-proline are

well-characterized osmoprotectants that enter the cytoplasm through the action of osmoregulatory

transporters and act as compatible solutes (Wood, 1999). Several open reading frames showing

homology to genes that are associated with transport systems for K

or osmoprotectants are found in

the S. mutans genome (Ajdic, et al., 2002). These include the trk genes, encoding K

transporters

(Dosch, et al., 1991, Poolman, et al., 2002, Epstein, 2003), and the Opu (osmoprotectant uptake)

system genes, encoding transporters for compatible solutes (Kempf & Bremer, 1998). However, the

interaction of these genes in osmoadaptation has not been determined in S. mutans.

The bacterial cell envelope is the first line of defense against environmental stress. Therefore,

surface proteins are thought to play an important role in their environment (Sutcliffe & Russell, 1995,

Navarre & Schneewind, 1999). Lipoproteins, a major group of surface proteins, have N-terminal lipid

modifications and are thought to be linked to the bacterial cell membrane by a prolipoprotein

diacylglyceryl transferase (Lgt) (Sankaran & Wu, 1994). Lipoproteins were first identified in E. coli

(Hantke & Braun, 1973) and have since been identified as membrane constituents in all types of

bacteria. The signal sequences of lipoproteins have a consensus motif called a “lipo-box”, which

contains the invariable N-terminal cysteine of the mature lipoprotein. Lipoproteins contribute to

Accepted Article

nutrient acquisition (Perego, et al., 1991, Russell, et al., 1992, Alloing, et al., 1994), adherence

(Jenkinson, 1994, Kolenbrander, et al., 1998), adaptation to environmental changes (Kappes, et al.,

1999), and protein maturation (Overweg, et al., 2000). In addition, lipoproteins are involved in the

virulence of bacterial pathogens (Stoll, et al., 2005, Basavanna, et al., 2009, Das, et al., 2009,

Nguyen, et al., 2010). Therefore, lipoproteins are predicted to play an important role in the interaction

between pathogenic bacteria and their hosts.

In this study, we examined the relationship between a putative lipoprotein, PrtM, and several

environmental stresses, and showed that PrtM plays a critical role in osmodaptation using K

in S.

mutans.

Materials and Methods

Bacterial strains and culture conditions

S. mutans 109c (wild type) and its isogenic mutants constructed in this study were anaerobically

maintained (80% N

, 10% H

, and 10% CO

) at 37°C in a brain heart infusion broth (BHI; Difco

Laboratories, Detroit, MI, USA). Where stated, the medium was supplemented with the following: 0.3

M sodium chloride (NaCl); 20 mM potassium chloride (KCl); 20 mM glycine betaine

(Sigma-Aldrich, St. Louis, MO, USA); 20 mM

-proline (Sigma-Aldrich); or 20 mM choline. When

required, 50 µg mL

tetracycline or 10 µg mL

erythromycin was added to the medium.

Accepted Article

Construction of a prtM-deficient S. mutans 109c mutant

Genomic DNA from S. mutans 109c was extracted using a GenElute bacterial genomic DNA kit

(Sigma-Aldrich). A prtM-deficient S. mutans 109c mutant strain was generated by a polymerase chain

reaction (PCR)-based gene replacement with an antibiotic resistance gene cassette. The S. mutans

UA159 genome sequence (Ajdic, et al., 2002) (GenBank accession number AE014133) was used as a

reference to design PCR primers. A 300-bp fragment containing the upstream flanking region and 5’

end portion of prtM was amplified using primers P1-F

(5′-CTGTTCTAGAGTGTTTAGAGATTGGCGG-3′) and P2-R

(5′-GCATCAACATGAGCTAAAACTCCAATATTAATAATTTTCATTCTTGATAAACTCCTTTT TGTCATTAAC-3′). A 301-bp fragment containing the downstream flanking region and 3’ end portion of prtM was amplified using primers P3-F

(5′-CGGATAGATAAAGTACGATATATGTTCAATAAAATAACTTAGAGGACTTGTAAAGAT TGACG-3′) and P4-R (5′-CTGTAATGGTAAATTTACCGCCTGGCGACC-3′). The tetracycline resistance gene (Tc

) was amplified from pUCTet (Arimoto & Igarashi, 2008) using the primer pair

P2-F

(5′-GTTAATGACAAAAAGGAGTTTATCAAGAATGAAAATTATTAATATTGGAGTTTTAGCT CATGTTGATGC-3′) and P3-R

(5′-CGTCAATCTTTACAAGTCCTCTAAGTTATTTTATTGAACATATATCGTACTTTATCTAT

Accepted Article

CCG-3′). Reverse primer P2-R and forward primer P3-F were synthesized with additional nucleotides complementary to the 5′- and 3′-terminal regions of Tc

, respectively. PCR amplification of partial S.

mutans DNA fragments was performed in a total volume of 50 μ L containing: 1 × buffer, 1.5 mM

MgCl

, 0.2 mM each of the dNTP, 10 pmol each of the primers, 1.25 U LA-Taq DNA polymerase

(Takara, Shiga, Japan) and 50 ng S. mutans 109c template DNA. The cycling program comprised 3

min at 94°C, 30 cycles of 45 s at 94°C and 2 min at 68°C, followed by a final extension of 10 min at

72°C. In a similar manner, (Tc

) was amplified using the pUCTet as a template. All three fragments

were annealed in one reaction and amplified by PCR using the primer pair P1-F/P4-R. The prtM gene

was completely replaced by the Tc

gene in the resultant amplicon, which was then used to transform

S. mutans 109c cells. prtM-deficient mutants were selected on BHI agar plates containing 50 μg mL

tetracycline. Replacement of prtM with Tc

was verified by PCR.

Construction of a prtM-complemented strain

The prtM-complemented strain was prepared by a single crossover recombination as reported

previously (Arimoto & Igarashi, 2008). Briefly, the complete prtM region with a portion of its

upstream-flanking region was amplified using primer pair CP-F

(5′-TTTTGCATGCCTGTTCTAGAGTGTTTAGAGATTGGCGG-3′; SphI site underlined) and CP-R (5′-TTTTGTCGACTTATTCCGCTGCTGTTGTCTC-3′; SalI site double underlined) and cloned into pUCEm (pUC18 containing the erythromycin-resistance gene) (Arimoto & Igarashi, 2008) digested

with the corresponding restriction enzymes. The resultant plasmid was amplified using a primer pair

Accepted Article

containing a XhoI restriction site, digested with the corresponding enzyme, and then self-ligated to

remove the ampicillin-resistance gene. The resulting plasmid was introduced into the prtM-deficient

S. mutans 109c strain. The prtM-complemented strain was identified by growth on the medium

containing both tetracycline and erythromycin. A single crossover event was supposed to occur at the

upstream-flanking region of the prtM so that the complete prtM should be reinserted at the same

position with same direction as compared with the chromosomal DNA of the wild type. The single

crossover complementation of the prtM was confirmed by PCR and sequence analysis. The resultant

prtM-complemented strain was maintained under erythromycin pressure until use.

General phenotypic characterization analysis

The bacterial hydrophobicity, sonication resistance, and sucrose dependent adhesion ability of S.

mutans strains were examined as described by Guo et al. (Guo, et al., 2013). The bacterial

hydrophobicity was determined by assessment of adhesion to hydrocarbon (N-hexadecane).

Sonication resistance (frequency of 20 kHz and output power of 10 watts) of S. mutans (10

colony

forming units (CFU)) was assayed by counting viable cells following sonication for 5 min. To assess

the sucrose-dependent adhesion ability, 0.2 mL of S. mutans (2.0×10

CFU) were cultured in 1.8 mL

of BHI medium containing 20 mM sucrose for 3 h in inclined glass tubes (AGC Techno Glass, Tokyo,

Japan).

Accepted Article

S. mutans growth under acidic, oxidative, or osmotic stress conditions

Differences in sensitivity to acid, oxygen, and osmotic stress between the wild-type and

prtM-deficient mutant were assessed by comparison of the growth curve. Bacterial growth was

determined by measuring the optical density (OD) at 600 nm of cultures at the time indicated. In this

study, S. mutans strains used for experiments were always prepared from log-phase cultures.

Exponential phase cells were collected by centrifugation at 5,000 × g for 10 min at room temperature.

The harvested cells were washed twice with phosphate-buffered saline (PBS) and then adjusted to an

OD

of 1.0 with PBS. The adjusted cells were exposed to the following environmental stress

conditions with 20-fold dilution to the media. For exposing acid stress, the prepared S. mutans cells

were inoculated to BHI adjusted to a pH of 4.0, 4.5, or 5.0. To evaluate the effect of oxygen on S.

mutans growth, the bacterial cells were cultivated in BHI under aerobic conditions with shaking at

200 rpm using BioShaker BR23FP (TAITEC, Saitama, Japan). An osmoadaptation test was

performed using a BHI with and without extra NaCl. Our previous study using BHI containing 0.1-0.5

M NaCl revealed that 0.3 M NaCl was the most appropriate concentration to see the difference in the

growth between the wild-type and the lgt-deficient mutant (unpublished data). Therefore, 0.3 M NaCl

was used in this study to identify the osmoadaptation-related lipoprotein in S. mutans. To examine

whether addition of osmoprotectants could overcome growth retardation caused by excess NaCl, 20

Accepted Article

mM KCl, 20 mM

-proline, 20 mM choline, or 20 mM glycine betaine was added to the hyperosmotic

medium.

Preparation of cells for gene expression analysis

An overnight culture of the wild-type109c grown in a BHI was diluted 20-fold in 5 mL of fresh BHI

and then anaerobically incubated at 37°C to an OD

of 0.4. The culture was split into two aliquots,

and the cells were harvested by centrifugation at 5000 × g for 10 min at room temperature. The

harvested cells were washed twice with PBS and then resuspended in 2 mL of BHI with or without

0.3 M NaCl. Resuspended bacterial cells were incubated anaerobically for 30 or 75 min at 37°C. At

the end of each incubation time, a 2× volume of RNA Protect (Qiagen, Germantown, MD, USA) was

added to the culture and mixed immediately. The cell pellet was collected by centrifugation at 5000 ×

g for 10 min at room temperature and used for RNA isolation.

RNA isolation and quantitative reverse-transcriptase PCR (qRT-PCR)

Total RNA from the wild-type 109c cell pellets was isolated using an RNeasy mini kit (Qiagen)

according to the manufacturer's instructions. Extracted RNA samples were treated with TURBO

DNA-free (Ambion, Austin, TX, USA) to remove any trace chromosomal DNA contamination. The

concentration and quality of the RNA samples were confirmed by measuring the absorbance ratio

(A260/A280 in 10 mM Tris-Cl buffer, pH 7.5) using a NanoDrop spectrophotometer (Thermo Fisher

Scientific, Waltham, MA, USA), and by 1.2% agarose gel electrophoresis, followed by ethidium

Accepted Article

bromide staining. Total RNA (2 μg) was reverse-transcribed using a Superscript Reverse Transcriptase (RT) kit (Life Technologies Corporation, Carlsbad, CA, USA) according to the

manufacturer's protocol. qRT-PCR was performed in a 1× SYBR Green Master Mix (Applied

Biosystems, Warrington, UK) with specific primer pairs (2 ng µL

) and 0.5 ng µL

cDNA sample in

a 20-µL total volume. Thermal cycler conditions included one cycle at 95°C for 90 s, followed by 40

cycles of 95°C for 15 s and 60°C for 1 min. Non-template controls were also included to confirm the

absence of primer-dimer formation. All samples were analyzed in triplicate on an ABI Prism 7000

detection system (Life Technologies Corporation). The expression level of prtM was normalized

using the 16S rRNA gene of S. mutans as an internal standard. Values are expressed as fold increases

in mRNA levels relative to those for unstimulated (suspended in BHI) cells. A 95-bp fragment of

prtM was amplified by the primer pair prtM-F (5′-ACCGGAAGTAACAGCTCAAGTG-3′) and prtM-R (5′-TAGCAAAGTCTGCACCATCTGCCT-3′). A portion of 16S rRNA was amplified using a primer pair Sm16S-F (5’-CCTACGGGAGGCAGCAGTAG-3’) and Sm16S-R

(5’-CAACAGAGCTTTACGATCCGAAA).

Statistical analysis

Growth data are shown as representative results from experiments performed independently in

triplicate. All data points are the mean values ± standard deviations (SD) of three samples. Results for

Accepted Article

ODs were compared using a two-tailed Student’s t-test with the multiple comparison procedure as

necessary.

Results and Discussion

General phenotypic characterization of the prtM-deficient S. mutans 109c strain

Comparative analysis of the osmoadaptation of S. mutans wild-type and its isogenic lgt-deficient

mutant (all lipoproteins are eliminated from the cell surface) demonstrated that the mutant was more

sensitive to osmotic stress than the wild-type, indicating that S. mutans has at least one

osmoadaptation-related lipoprotein (data not shown). Genome sequence analysis of S. mutans

performed by Ajdic et al. revealed that this organism may have 27-35 putative lipoproteins (Ajdic, et

al., 2002). Based on this information, we performed a comprehensive mutational study of lipoproteins

and clarified that the loss of PrtM (also known as PrsA) (GenBank accession no. AAN58382, gene

locus tag SMU_648) resulted in increased osmosensitivity when compared to the wild-type strain

(Fig. 1A). Recently, PrsA from S. mutans UA140 was found to be part of the general secretion

machinery, and is likely involved in the folding and maturation of secreted surface proteins (Guo, et

al., 2013). Various phenotypic alterations of the prsA mutant were demonstrated in this previous

report. Therefore, to confirm if the similar phenotypic alterations were also observed in the prtM

mutant, we focused on the following results from Guo et al.: the prsA mutant was i) more

Accepted Article

hydrophobic on the cell surface, ii) more sensitive to the sonication, iii) reduced ability in early

biofilm formation. The cell surface of the prtM mutant was more hydrophobic than that of the

wild-type strain (data not shown). For sonication resistance and biofilm formation ability, similar

tendencies to those observed for S. mutans UA140 were identified though no statistically significant

differences were detected between the wild-type and prtM mutant under our experimental conditions.

The reasons for the slightly discrepant results between the two studies might be differences in

sonication conditions (22kHz with 10 watt output for UA140 and 20 kHz with 10 watt output for

109c) for sonication resistance, and in strains used for biofilm formation ability.

PrtM is related to osmoadaptation of S. mutans

To clarify the role of PrtM in various environmental adaptations, we examined the growth of the

wild-type and prtM-deficient mutant in a BHI in the presence or absence of environmental stress (Fig.

1). Growth of the wild-type and prtM mutant was very similar in the control BHI medium (data not

shown here). However, growth of the prtM mutant was impaired compared with that of the wild-type

in a BHI supplemented with 0.3 M NaCl (hyperosmotic medium) (Fig. 1A). When S. mutans was

subjected to acidic or oxidative stress, no obvious differences in growth were observed between the

wild-type and prtM mutant (Fig. 1B, 1C). In this study, we found the relationship between PrtM and

osmolality; however, as the PrtM is predicted to be involved in folding/maturation of various surface

proteins, the PrtM may contribute to adaptation for other environmental stress conditions that were

not examined in this report.

Accepted Article

Use of osmoprotectants in osmoadaptation of S. mutans

To examine the ability of osmoprotectants to protect S. mutans from the effects of increased

NaCl, the growth of the wild-type 109c in hyperosmotic medium supplemented with choline, glycine

betaine,

-proline, or KCl was examined. Impairment of growth of the wild-type in the presence of 0.3

M NaCl was mitigated by addition of KCl (Fig. 2). However, the addition of other osmoprotectants

did not show obvious effect on bacterial growth under conditions of high osmolality (Fig. 2). The

concentrations of glycine betaine, choline, and

-proline used in this study were much higher (20-fold)

than those used in studies of B. subtilis and L. monocytogenes (Nau-Wagner, et al., 1999, Bayles &

Wilkinson, 2000). Therefore, it seems that S. mutans preferably use K

compared to other compatible

solutes tested under our experimental conditions. Further experiments using combinations of

osmoprotectants might provide more useful information.

Involvement of PrtM in K

rescue of S. mutans growth under hyperosmotic conditions

Growth of the wild-type 109c, prtM mutant, and prtM-complemented strain was examined in the

hyperosmotic medium with and without KCl (Fig. 3A). The detailed growth behaviors at 6.5 h

post-inoculation for these strains were also shown in Fig. 3B. As described above, impaired growth of

the wild-type strain by addition of 0.3 M NaCl was mitigated by supplementation with KCl. However,

such recovery completely disappeared when PrtM was eliminated from the wild-type (Fig. 3A, 3B).

When the complete prtM region was introduced by single crossover recombination in the prtM

Accepted Article

mutant, growth was completely restored to levels comparable with that of the wild-type in the

KCl-containing medium (Fig. 3A, 3B). These result suggest that S. mutans PrtM plays a critical role

in KCl use for osmoadaptaion.

Fig. 3A also showed the growth behavior of the wild-type and the prtM mutant in unmodified

BHI. Although the slight difference was recognized in the growth curve, growth of the wild-type and

prtM mutant was very similar with doubling times of 76 min and 79 min, respectively.

Transcriptional analysis of prtM in response to osmotic stress

To determine whether prtM is induced by osmotic stress, transcriptional levels of prtM during growth

under high osmolality conditions were compared with those in a BHI medium using qRT-PCR

analysis. Expression level of the prtM in the wild type S. mutans in normal BHI was referred as

control at each time point indicated. No apparent difference was observed in the transcriptional levels

of prtM in the presence or absence of osmotic stress for the initial 30 min of growth. However, prtM

expression was enhanced after 75 min of osmotic stimulation (approximately 5.7-fold induction

compared with those in the wild-type without stress) (Fig. 4). This result suggests that prtM is an

osmoresponsive gene in S. mutans.

From these findings, we concluded that S. mutans PrtM may act as a proteinase and/or foldase,

and modify single or multiple protein(s) that are related to K

use. Other genetic mutational analyses,

such as an investigation of the trk genes, and enzymatic activity assays of PrtM would lead to a better

Accepted Article

understanding of the osmoadaptation mechanisms of S. mutans. In addition to its role in contributing

to the cariogenic properties of S. mutans, such as biofilm formation, our present study also indicates

that PrtM plays an important part in osmoadaptation, which is necessary for S. mutans survival in the

fluctuating ionic strength of plaque fluid in the oral cavity. Therefore, we hypothesize that PrtM could

be an attractive target molecule for the development of new treatments for preventing human dental

caries. We believe that the present study is the first to propose an osmoadaptation mechanism via K

use in S. mutans. In addition, lipoprotein PrtM appears to be an indispensable molecule for

K

-mediated osmoadaptation.

Acknowledgements

This work was supported in part by a Grant-in Aid for Young Scientists (B) (grant no. 23792113) and

by the Private University High Technology Research Center Project (grant no. S1001010) from the

Ministry of Education, Culture, Sports, Science, and Technology of Japan.

References

Abranches J, Lemos JA & Burne RA (2006) Osmotic stress responses of Streptococcus mutans

UA159. FEMS Microbiol Lett 255: 240-246.

Ajdic D, McShan WM, McLaughlin RE, et al. (2002) Genome sequence of Streptococcus mutans

UA159, a cariogenic dental pathogen. Proc Natl Acad Sci U S A 99: 14434-14439.

Accepted Article

Alloing G, de Philip P & Claverys JP (1994) Three highly homologous membrane-bound lipoproteins

participate in oligopeptide transport by the Ami system of the gram-positive Streptococcus

pneumoniae. J Mol Biol 241: 44-58.

Arimoto T & Igarashi T (2008) Role of prolipoprotein diacylglyceryl transferase (Lgt) and

lipoprotein-specific signal peptidase II (LspA) in localization and physiological function of

lipoprotein MsmE in Streptococcus mutans. Oral Microbiol Immunol 23: 515-519.

Basavanna S, Khandavilli S, Yuste J, et al. (2009) Screening of Streptococcus pneumoniae ABC

transporter mutants demonstrates that LivJHMGF, a branched-chain amino acid ABC

transporter, is necessary for disease pathogenesis. Infect Immun 77: 3412-3423.

Bayles DO & Wilkinson BJ (2000) Osmoprotectants and cryoprotectants for Listeria monocytogenes.

Lett Appl Microbiol 30: 23-27.

Csonka LN (1989) Physiological and genetic responses of bacteria to osmotic stress. Microbiol Rev

53: 121-147.

Das S, Kanamoto T, Ge X, Xu P, Unoki T, Munro CL & Kitten T (2009) Contribution of lipoproteins

and lipoprotein processing to endocarditis virulence in Streptococcus sanguinis. J Bacteriol

191: 4166-4179.

Accepted Article

Dosch DC, Helmer GL, Sutton SH, Salvacion FF & Epstein W (1991) Genetic analysis of potassium

transport loci in Escherichia coli: evidence for three constitutive systems mediating uptake

potassium. J Bacteriol 173: 687-696.

Epstein W (2003) The roles and regulation of potassium in bacteria. Prog Nucleic Acid Res Mol Biol

75: 293-320.

Graham JE & Wilkinson BJ (1992) Staphylococcus aureus osmoregulation: roles for choline, glycine

betaine, proline, and taurine. J Bacteriol 174: 2711-2716.

Guo L, Wu T, Hu W, et al. (2013) Phenotypic characterization of the foldase homologue PrsA in

Streptococcus mutans. Mol Oral Microbiol 28: 154-165.

Hamada S & Slade HD (1980) Biology, immunology, and cariogenicity of Streptococcus mutans.

Microbiol Rev 44: 331-384.

Hantke K & Braun V (1973) Covalent binding of lipid to protein. Diglyceride and amide-linked fatty

acid at the N-terminal end of the murein-lipoprotein of the Escherichia coli outer

membrane. Eur J Biochem 34: 284-296.

Ingraham JL (1987) Effect of temperature, pH, water activity, and pressure on growth In:. American

Society for Microbiology, Washington, D. C.

Accepted Article

Jenkinson HF (1994) Cell surface protein receptors in oral streptococci. FEMS Microbiol Lett 121:

133-140.

Kappes RM, Kempf B, Kneip S, Boch J, Gade J, Meier-Wagner J & Bremer E (1999) Two

evolutionarily closely related ABC transporters mediate the uptake of choline for synthesis

of the osmoprotectant glycine betaine in Bacillus subtilis. Mol Microbiol 32: 203-216.

Kempf B & Bremer E (1998) Uptake and synthesis of compatible solutes as microbial stress

responses to high-osmolality environments. Arch Microbiol 170: 319-330.

Kolenbrander PE, Andersen RN, Baker RA & Jenkinson HF (1998) The adhesion-associated sca

operon in Streptococcus gordonii encodes an inducible high-affinity ABC transporter for

Mn2+ uptake. J Bacteriol 180: 290-295.

Measures JC (1975) Role of amino acids in osmoregulation of non-halophilic bacteria. Nature 257:

398-400.

Nau-Wagner G, Boch J, Le Good JA & Bremer E (1999) High-affinity transport of choline-O-sulfate

and its use as a compatible solute in Bacillus subtilis. Appl Environ Microbiol 65: 560-568.

Navarre WW & Schneewind O (1999) Surface proteins of gram-positive bacteria and mechanisms of

their targeting to the cell wall envelope. Microbiol Mol Biol Rev 63: 174-229.

Accepted Article

Nguyen HT, Wolff KA, Cartabuke RH, Ogwang S & Nguyen L (2010) A lipoprotein modulates

activity of the MtrAB two-component system to provide intrinsic multidrug resistance,

cytokinetic control and cell wall homeostasis in Mycobacterium. Mol Microbiol 76:

348-364.

Overweg K, Kerr A, Sluijter M, et al. (2000) The putative proteinase maturation protein A of

Streptococcus pneumoniae is a conserved surface protein with potential to elicit protective

immune responses. Infect Immun 68: 4180-4188.

Perego M, Higgins CF, Pearce SR, Gallagher MP & Hoch JA (1991) The oligopeptide transport

system of Bacillus subtilis plays a role in the initiation of sporulation. Mol Microbiol 5:

173-185.

Poolman B, Blount P, Folgering JH, Friesen RH, Moe PC & van der Heide T (2002) How do

membrane proteins sense water stress? Mol Microbiol 44: 889-902.

Russell RR, Aduse-Opoku J, Sutcliffe IC, Tao L & Ferretti JJ (1992) A binding protein-dependent

transport system in Streptococcus mutans responsible for multiple sugar metabolism. J Biol

Chem 267: 4631-4637.

Sankaran K & Wu HC (1994) Lipid modification of bacterial prolipoprotein. Transfer of

diacylglyceryl moiety from phosphatidylglycerol. J Biol Chem 269: 19701-19706.

Accepted Article

Stoll H, Dengjel J, Nerz C & Gotz F (2005) Staphylococcus aureus deficient in lipidation of

prelipoproteins is attenuated in growth and immune activation. Infect Immun 73:

2411-2423.

Sutcliffe IC & Russell RR (1995) Lipoproteins of gram-positive bacteria. J Bacteriol 177: 1123-1128.

Whatmore AM & Reed RH (1990) Determination of turgor pressure in Bacillus subtilis: a possible

role for K+ in turgor regulation. J Gen Microbiol 136: 2521-2526.

Whatmore AM, Chudek JA & Reed RH (1990) The effects of osmotic upshock on the intracellular

solute pools of Bacillus subtilis. J Gen Microbiol 136: 2527-2535.

Wood JM (1999) Osmosensing by bacteria: signals and membrane-based sensors. Microbiol Mol Biol

Rev 63: 230-262.

Figure legends

Figure 1 Growth behavior of S. mutans under various types of environmental stress. The wild-type

and prtM-deficient mutant were grown in a BHI broth or under conditions of hyperosmotic stress (A),

acidic stress (B), or oxidative stress (C). Bacterial growth was determined by measuring the optical

density at 600 nm (OD

). Closed circles, wild type; open squares, prtM mutant. Solid lines, dotted

lines, and dashed lines shown in (B) represent growth at pH 5.0, pH 4.5, and pH 4.0, respectively.

Growth data are representative results for experiments performed three times.

Accepted Article

Figure 2 Use of osmoprotectants by S. mutans under high osmolality conditions. The wild-type was

grown in a BHI with NaCl (closed circles), or BHI with NaCl containing either 20 mM choline (open

triangles), 20 mM glycine betaine (open squares), 20 mM

-proline (open diamonds), or 20 mM KCl

(open circles). OD results were compared using the two-tailed Student’s t-test. Statistical significance

(P < 0.05) is indicated by asterisks.

Figure 3 K

use by S. mutans in a high osmolality medium. (A) The wild-type, prtM mutant, and

prtM-complemented strain were grown in a BHI (solid lines), BHI-NaCl (dotted lines), or BHI-NaCl

supplemented with 20 mM KCl (dash-dot-dashed lines). Wild-type 109c, closed circles; prtM mutant,

open squares; prtM-complemented strain, open triangles. Data points represent mean values of three

independent experiments with standard deviation. (B) Detailed growth behavior for S. mutans at 6.5 h

post-inoculation, as indicated by dotted line square in (A). Statistical significance (P < 0.05; Dunnett’s

test) is indicated by asterisks.

Figure 4 Transcription of prtM in S. mutans. Total RNA was extracted from wild-type 109c cells

cultured in a BHI in the presence or absence of 0.3 M NaCl. The expression levels (relative to cells

cultured in BHI) of prtM, corrected to the 16S rRNA housekeeping gene, are shown. Expression

levels of the prtM in the wild type S. mutans in BHI in the absence of NaCl was referred as control at

each time point indicated. Data shown are the mean ± SD for results from three independent

experiments. Statistical significance (P < 0.05; Dunnett’s test) is indicated by an asterisk.

Accepted Article

Accepted Article

Accepted Article

Accepted Article