博 士 学 位 論 文
イバブラジンおよびβ遮断薬慢性治療による
交感神経活動および分布の修飾:高血圧性
心不全ラットにおける検討
筧
和
剛
イバブラジンおよびβ遮断薬慢性治療による交感神経活動および分布の修飾:高血圧性心不全ラットにおける検討 筧 和 剛近 畿 大 学 大 学 院
医 学 研 究 科 医 学 系 専 攻
Doctoral Dissertation
Modulation of sympathetic activity and innervation with
chronic ivabradine and β-blocker therapies: analysis of
hypertensive rats with heart failure
Department of Cardiology, Major in Medical Sciences
Kindai University Graduate School of Medical Sciences
Kazuyoshi Kakehi
November 2018
Modulation of sympathetic activity and innervation
with chronic ivabradine and β-blocker therapies:
analysis of hypertensive rats with heart failure
Kazuyoshi Kakehi MD*1, Yoshitaka Iwanaga MD*1, Heitaro Watanabe MD1, Takashi Sonobe PhD2,
Tsuyoshi Akiyama MD2, Shuji Shimizu MD2, Hiromi Yamamoto MD1, and Shunichi Miyazaki MD.1
1 Division of Cardiology, Department of Internal Medicine, Kindai University Faculty of Medicine
2 Department of Cardiac Physiology, National Cerebral and Cardiovascular Center
*Both authors contributed equally to the work. ABSTRACT
Background: Whether the reduction of heart rate with ivabradine (IVA) could affect sympathetic activation and cardiac innervation in heart failure (HF) remains unknown.
Purpose: The present study assessed the chronic effects of IVA and β-blocker on the systemic and local sympathetic nervous systems of hypertensive animals with HF.
Methods and Results: The Dahl salt-sensitive rats received chronic IVA, bisoprolol (BIS), or placebo (CTL) therapy. The survival of the animal models with IVA and BIS significantly improved (median; 19.7 in IVA and 19.7 in BIS vs. 17.0 weeks in CTL, P<0.001). A similar decrease in 24-hour heart rate (mean; 305 in IVA and 329 in BIS vs. 388 bpm in CTL, p<0.001) without effect on blood pressure, and an improvement in the left ventricular dysfunction (mean fractional shortening; 56.7 in IVA and 47.8 in BIS vs. 39.0 % in CTL, p<0.001) were observed in the animals with IVA and BIS. However, a negative inotropic effect was only observed in the animals with BIS. Excessive urinary noradrenaline excretion in animals with CTL was only suppressed with the use of IVA (mean; 1.35 in IVA and 1.95 in BIS vs. 2.27 μg/day in CTL, p=0.002). In contrast, atrial noradrenaline and acetylcholine depletion in the animals with CTL improved and the tyrosine hydroxylase expression in the both atria were restored with the use of both IVA and BIS.
Conclusions: IVA therapy improved the survival of hypertensive animals with HF. Furthermore, it was asso-ciated with the amelioration of systemic sympathetic activation and cardiac sympathetic and parasympathetic nerve innervations. Chronic β-blocker therapy with negative inotropic effects had beneficial effects only on cardiac innervations.
INTRODUCTION
The sympathetic nervous system (SNS) is important for compensatory mechanisms that maintain cardio-vascular homeostasis. Heart failure (HF) has been thought to be a condition associated with SNS activation, and it is a reflex reaction to changes in cardiac and peripheral hemodynamics, which is initially compensatory
one, but ultimately pathological one (1). Chronic β-blocker therapy ameliorates left ventricular (LV)
dys-function, reverses LV remodeling, and decreases the risk of hospitalization and mortality of individuals who
experienced HF, and it is now one of the established treatments for HF with reduced ejection fraction (2). A
variety of cardioprotective mechanisms have been attributed to the use of β-blockers. They include the pro-tection against the deleterious myocardial effects of catecholamines and the pharmacological actions, such as
negative inotropic and chronotropic effects associated with the reduction in myocardial oxygen consumption (3).
Heart rate (HR) is associated with clinical outcomes in a variety of cardiovascular diseases, such as hyper-tension and HF. Ivabradine (IVA) is an HR-lowering agent that acts specifically on the sinoatrial node by
inhibiting the If (funny channel) current of the pacemaker cells (4). In comparison with β-blockers, it does
not have negative inotropic effects, and it has no considerable impact on blood pressure. In the SHIFT trial, reducing HR by 11 beats per minute with the use of IVA decreased the primary endpoint (cardiovascular
death and hospitalized HF) (5). HR may be a modifiable factor, or IVA itself may have some protective effects
against HF in addition to HR reduction (pleiotropic action). Although HR is regulated by autonomic balance and autonomic activity plays an essential role as a pathogenetic factor of and a prognostic index of HF, the
effect of the therapeutic agent on the autonomic nervous system is not fully understood (6). Therefore, the
present study utilized the Dahl salt-sensitive (DS) rats with HF, which have been associated with the
activa-tion of SNS (7). Furthermore, the chronic effects of IVA on sympathetic activity and cardiac innervation were
assessed and compared with those of β-blockers in this animal model with HF. METHODS AND MATERIALS
Experimental protocol
Male inbred DS rats were fed with 8% high-salt (HS) diet after 6 weeks of age (8). 0.3% low-salt (LS) diet
was given throughout the experiment to only the rats of the LS group (n = 16), which have no hypertension or no left ventricular hypertrophy (LVH) and dysfunction throughout the study. After 11 weeks (LVH stage), the animals that were on HS diet received chronic IVA (IVA group, n = 39), bisoprolol (BIS group, n = 38), or placebo (CTL group, n = 38) treatment. 10 mg/kg/day of IVA was given in drinking water based
on a previous study (9). Moreover, 4 mg/kg/day of BIS was incorporated into the diet. This dosage was
selected to lower HR without affecting blood pressure (7).
In the first experiment, the rats (n = 66) were monitored, and death was recorded till 21 weeks. Serial blood pressure and echocardiographic measurements were obtained. In the second series, they (n = 65) were sacrificed at 17–18 weeks of age (HF stage), to obtain blood samples and heart tissues
(Supplementary Figure 1). The animals were treated in accordance with the guidelines of the Kindai University Faculty of Medicine.
Blood pressure/heat rate measurements and echocardiography
Systolic blood pressure (SBP) and HR were cautiously measured by the tail-cuff method at 10, 13, and 16 weeks. The telemetry (TA11PA-C10, Data Sciences International) was performed for measuring the BP and HR in conscious rats over 24 hours at approximately 15 weeks (n = 6 in each group), as described
previously (7). LV geometry and function were evaluated by echocardiography under light anesthesia with
1.5% isoflurane at 16 weeks (8). The LV end-diastolic dimension (LVDd), end-systolic dimension, posterior wall
thickness (PWT), intra-ventricular septal wall thickness (IVST), and left atrial (LA) dimension (LAD) were measured by short-axis view. LV fractional shortening (FS), ejection fraction (EF) and meridional end-sys-tolic wall stress (SWS) were calculated (LV SWS; SBP x LVDd x 1.35 / 4 x PWTsystole x [1+PWTsystole]
/ LVDd) (8). HR-corrected mean velocity of circumferential fiber shortening (cVcf) was calculated and LV
SWS-cVcf relationship as an index of HR- and load-independent systolic function was examined (10). Diastolic
functional parameters such as arly-to-late transmitral filling ratio (E/A) and the ratio of peak velocity of early mitral inflow to early diastolic velocity of the mitral annulus (E/E’) were also calculated by transmitral
Dop-pler flows and DopDop-pler tissue signal from the lateral mitral valve annulus (11).
Serum, urinary, and tissue biochemical measurements
Urine samples were collected for 24 hours in metabolic cages in the rats of 16 weeks old. Urinary param-eters such as urinary sodium, potassium, creatinine, nitrogen, total protein, and albumin or noradrenaline (NAd) and normetanephrine, were measured. The rats were sacrificed at 17–18 weeks, and serum sodium, potassium, creatinine, and urea nitrogen were measured by commercially available kits. The LV and atrial tissues were homogenized in 0.4 or 0.1 M perchloric acid containing ethylenediaminetetraacetic acid for the measurement of NAd or acetylcholine (ACh) concentrations, respectively. NAd, normetanephrine, and ACh
were determined with automated high-performance liquid chromatography (7, 12).
Histology
The formalin-fixed and paraffin-embedded tissues (LV and atria) were sliced into 5 μm sections. Hema-toxylin-eosin and Masson’s trichrome stainings were performed for the assessment of the myocyte diameters and myocardial interstitial fibrosis, as previously described (7). Immunofluorescence was performed using anti-tyrosine hydroxylase (TH) antibody (1:300, Abcam/EMD Millipore), followed by Alexa 594-conjugated anti-rabbit IgG (1:1000, Invitrogen), and the nuclei were counterstained using 4′ , 6-diamidino-2-phenylin-dole. Immunohistochemical staining for tyrosine hydroxylase (TH) was performed using the UltraTek HRP Anti-Polyvalent (DAB) Staining System (Scytek Laboratories) according to the manufacturer’s instructions.
Gene and protein expression analysis
RNA was isolated from LV and atria using TRIzol followed by treatment with DNase I (Invitrogen). First-strand cDNAs were synthesized using the SuperScript First-Strand Synthesis System Kit (Invitrogen) for quantitative real-time polymerase chain reaction (PCR) in StepOnePlus ™ system (Applied Biosystems). The mRNA levels were measured using specific primers (Supplementary Table) and normalized to an endoge-nous control; 18S rRNA mRNA.
40 mg of the right and left atrial and LV myocardium were homogenized in a 1 ml lysis buffer (CST). Each isolated protein sample (40 μg) was electrophoresed on 4–12% Bis-Tris gels and was transferred to PVDF membranes. They were incubated with rabbit anti-TH antibody (1:10000, Abcam) or rabbit anti-GAPDH (1:10000, CST). The proteins were detected with ECL Prime (GE Healthcare).
Statistical analyses
The groups were compared using ANOVA and the post-hoc Tukey HSD test for the individual group comparison was performed only when there is a significant difference by ANOVA. Two-way repeated measures ANOVA was used to compare the serial measurements in BW, HR, or SBP. The survival was analyzed by the Kaplan–Meier method, and a comparison was performed using the log-rank test. All data were reported as mean ± SD. A P value less than 0.05 was considered statistically significant.
RESULTS Survival analysis
All animals in the CTL group died from severe LV dysfunction followed by pulmonary congestion between 14.7 and 20.7 weeks (median survival: 17.0 weeks). The IVA (19.7 weeks) and BIS groups (19.7 weeks) had a significantly prolonged survival (P < 0.01) than the CTL group (Figure 1). There was no significant difference in terms of survival time of the IVA and BIS groups, which indicated that IVA and β-blocker had comparable efficacies.
Figure 1.Effects of ivabradine and bisoprolol treatment on survival. CTL, control group; IVA, ivabradine group; BIS, bisoprolol group.
Blood pressure/heat rate and echocardiographic measurements
The body weights (BWs) of the IVA and BIS groups increased (both P < 0.05 vs. the CTL group). No differences were observed among the three groups in terms of SBP. The IVA and BIS groups had a similar decrease in HR during the entire study period (Figure 2A). Moreover, telemetric analysis showed no significant differences in terms of the mean blood pressures of the animals from the three groups that were approximately 15 weeks old over 24 hours (Figure 2B). The IVA and BIS groups have comparable reduction in HR. Mean HRs differed between at daytime and nighttime in the CTL and IVA groups. However, they were conflicting. Echocardiography revealed improved LV FS and EF, and the significantly suppressed progression of LV hypertrophy (LV mass) and SWS at 16 weeks (the HF stage) in both the IVA and BIS rats (Table 1). Also, the LV SWS-cVcf relationship showed that IVA had preserved systolic function and BIS had slightly suppressed systolic function as compared with LS group, independent of HR and loading condition (Figure 2C). In the diastolic parameters, IVA showed decreased both E/A and E/E’ and BIS showed decreased E/A. In the BIS group, LV enlargement and the decrease of systolic parameter and the increase of diastolic functional parameter were admitted as compared with the IVA group, suggesting BIS had some negative inotropic/lusitropic effects.
Table 1.Echocardiographic parameters at 16 weeks
LS group CTL group IVA group BIS group P value
Number 7 12 12 12 HR (/min) 377 ± 38 392 ± 50 345 ± 43* 356 ± 37* 0.039 SBP (mmHg) 135 ± 16* 229 ± 18 245 ± 21 230± 19 <0.001 LV IVSTd (mm) 1.2 ± 0.1* 1.9 ± 0.1 1.6 ± 0.1* 1.6 ± 0.2* <0.001 LV Dd (mm) 7.5 ± 0.6 8.0 ± 1.1 7.1 ± 0.5* 7.5 ± 0.4 0.008 LV PWTd (mm) 1.3 ± 0.1* 1.9 ± 0.2 1.7 ± 0.2 1.7 ± 0.2 <0.001 LV Ds (mm) 3.1 ± 0.4* 5.0 ± 1.4 3.1 ± 0.4* 3.9 ± 0.3*# <0.001 FS (%) 59.1 ± 2.1* 39.0 ± 9.9 56.7 ± 5.1* 47.8 ± 3.4*# <0.001 EF (%) 93.1 ± 1.4* 75.7 ± 11.2 91.6 ± 3.2* 85.6 ± 2.7* <0.001 SWS (kdynes/cm2) 27.3 ± 8.0* 100.6 ± 50.9 40.4 ± 10.9* 57.9 ± 11.3* <0.001 LV mass (mg) 591 ± 72* 1166 ± 261 809 ± 112* 888 ± 62* <0.001 LAD (mm) 3.1 ± 0.3* 3.4 ± 0.2 2.9 ± 0.2* 3.1 ± 0.2* <0.001
Values were presented as mean ± SD. * p < 0.05 versus the CTL group. # p < 0.05 versus IVA group. Dd, dimension at diastole; Ds, dimension at systole; EF; ejection fraction; FS, fractional shortening; HR, heart rate; IVSTd, intra-ventricular septal thickness at diastole; LAD; left atrial dimension, LV, left ventricle; PWTd, posterior wall thickness at diastole; RDN, renal sympathetic denervation; SBP, systolic blood pressure; SWS, end-systolic wall stress; LS, low-salt diet group; CTL, control group; IVA, ivabradine group; BIS, bisoprolol group.
Figure 2.Changes in hemodynamics and echocardiographic parameters.
(A) Body weight, blood pressure, heart rate at 10–16 W, (B) 24-hour mean heart rate, mean blood pressure at 15 W. (C) LV SWS–cVcf relationship, and (D) diastolic functional parameters in echocardiography at 16 W. BP, blood pressure; cVcf, HR-corrected mean velocity of circumferential fiber shortening; E/A; early-to-late transmitral filling ratio, E/E’; the ratio of peak velocity of early mitral inflow to early diastolic velocity of the mitral annulus, HR, heart rate; LV, left ventricle; SWS, end-systolic wall stress; W, weeks. LS, low-salt group; CTL, control group; IVA, ivabradine group; BIS, bisoprolol group.
Serum, urinary, and tissue biochemical data
The urinary NAd and its metabolite normetanephrine excretions were significantly increased in the CTL group than in the LS group at 15 weeks, suggesting sympathetic overactivity in the CTL animals. By contrast, only the IVA group had significantly decreased urine NAd/normetanephrine excretion (Figure 3A). The high serum NAd and adrenaline concentrations observed in the CTL group were significantly inhibited in the IVA and BIS groups at 17 weeks. The reduced LV NAd amount in the CTL group was significantly restored only with the use of BIS, which indicated the preserved LV sympathetic function. By contrast, the NAd amount in the right atrium (RA) and LA was significantly restored in both the IVA and BIS groups (Figure 3B). Furthermore, the decreased ACh content in the RA was restored in both the IVA and BIS
groups, whereas that in the LA was restored only in the BIS group (Figure 3C).
Figure 3.Changes in catecholamines and acetylcholine levels in the urine and cardiac tissues.
(A) Noradrenaline and normetanephrine levels in the urine. (B) Noradrenaline levels in the tissues; left ventricle and right and left atria. (C) Acetylcholine levels in the right and left atria. LS, low-salt group; CTL, control group; IVA, ivabradine group; BIS, bisoprolol group. The values were presented as mean ± SD.
At 17 weeks, the BIS group had higher creatinine clearance than the CTL group. By contrast, the IVA group showed a significantly lower urine albumin excretion than the CTL group (Table 2).
Histological analysis of the LV and atria at 17 weeks
The IVA and BIS groups had a significantly reduced lung weight to BW ratio than the CTL group, which indicated the decrease of pulmonary congestion (Table 2). Moreover, significant reductions in both LV/BW and LA/BW ratios were observed. The CTL group presented with myocyte hypertrophy and myocardial fibrosis in the LV. The IVA and BIS groups had significantly less myocyte diameters (14.5 ± 0.7, 20.7 ± 0.9, 17.6 ± 0.7, and 17.8 ± 0.9 μm for LS, CTL, IVA, and BIS groups, respectively) and significantly less inter-stitial fibrosis area (2.48 ± 0.70%, 5.55 ± 0.93%, 3.75 ± 0.61%, and 4.05 ± 0.72% for LS, CTL, IVA, and BIS groups, respectively) than the CTL group (Supplementary Figure 2).
Table 2.Serum/urine measurements and heart/lung/kidney weights at 17 weeks
LS group CTL group IVA group BIS group
Number 6 8 8 9
Serum measurements
Sodium level (mEq/L) 157.0 ± 2.3 160.4 ± 5.9 157.1 ± 2.4 158.4 ± 2.7
Potassium level (mEq/L) 4.7 ± 0.6 4.6 ± 0.4 4.8 ± 0.5 4.3 ± 0.3
Urea nitrogen level (mg/dL) 21.5 ± 1.2* 31.2 ± 9.7 27.7 ± 7.9 22.7 ± 5.2*
Creatinine level (mg/dL) 0.26 ± 0.10* 0.52 ± 0.07 0.52 ± 0.15 0.44 ± 0.09 Ccr level (mL/min/100 g) 0.79 ± 0.20* 0.43 ± 0.08 0.49 ± 0.12 0.59 ± 0.10* Noradrenaline level (pg/mL) 351.7 ± 118.9* 1392.0 ± 786.4 692.0 ± 304.4* 627.1 ± 363.9* Adrenaline level (pg/mL) 180.7 ± 57.1* 585.2 ± 296.1 371.4 ± 66.6* 273.6 ± 76.2* Dopamine level (pg/mL) 96.2 ± 65.2 149.5 ± 145.6 125.5 ± 57.6 100.1 ± 40.3 Urine measurements Albumin (mg/day) 4.8 ± 3.7* 26.0 ± 3.4 14.5 ± 3.5* 22.7 ± 3.4 Protein (mg/day) 35.8 ± 41.8* 394.0 ± 37.4 456.1 ± 39.4 374.2 ± 37.4 Organ weights LV/BW (mg/g) 2.21 ± 0.05* 4.87 ± 0.30 4.22 ± 0.42* 3.85 ± 0.61* LA/BW (mg/g) 0.13 ± 0.00* 0.43 ± 0.06 0.25 ± 0.05* 0.28 ± 0.11* RA/BW (mg/g) 0.12 ± 0.01* 0.22 ± 4.87 0.18 ± 0.02 0.20 ± 0.06 Lung/BW (mg/g) 3.69 ± 20.31* 14.12 ± 4.95 5.53 ± 1.85* 7.12 ± 4.34* Kidney/BW (mg/g) 3.51 ± 0.16* 7.02 ± 0.70 6.40 ± 0.70 5.77 ± 0.68*
Values were presented as mean ± SD. * p < 0.05 versus the CTL group.
BW, body weight; Ccr, creatinine clearance; LA, left atrium; LV, left ventricle; RA, right atrium; LS, low-salt diet group; CTL, control group; IVA, ivabradine group; BIS, bisoprolol group.
mRNA expression in the LV and atria
Table 2 depicts the changes in the mRNA in the LV and both atria. In LV myocardium, the mRNA expres-sion levels of the atrial natriuretic peptide (ANP), angiotensin-converting enzyme, arginine vasopressin, and endothelin-1 were significantly suppressed in the IVA and BIS groups compared with the CTL group. There were no differences in the mRNA levels of the β-myosin heavy chain and collagen-type Ia (Col1a1) among the three groups. Although the β1-adrenergic receptor and nerve growth factor mRNA expressions were reduced in the CTL group in comparison with the LS group, they were restored in the IVA and BIS groups (p < 0.05). An increase in both HCN2 and HCN4 mRNA was observed in the BIS group. However, only HCN4 mRNA increased in the IVA group. In RA, HCN2 mRNA was decreased in the IVA and BIS groups com-pared with the LS group. In LA, ANP and Col1a1 were significantly suppressed in the IVA and BIS groups compared with the CTL group. There were no differences in the both HCN2 and HCN4 mRNAs.
Table 3.mRNA expressions via quantitative real-time RT-PCR analysis
LS group CTL group IVA group BIS group P value
LV ANP 1.03 ± 0.36 33.90 ± 23.98* 18.73 ± 10.90*# 20.03 ± 8.06*# 0.001 β MHC 1.01 ± 0.11 4.98 ± 1.48* 4.90 ± 1.23* 5.38 ± 1.89* <0.001 Col 1a1 1.06 ± 0.40 2.14 ± 0.80* 2.60 ± 0.84* 2.86 ± 1.42* 0.002 ACE 1.06 ± 0.39 7.12 ± 2.99* 3.99 ± 1.71*# 3.58 ± 1.35*# <0.001 ET-1 1.01 ± 0.44 2.85 ± 1.16* 2.22 ± 0.65* 1.74 ± 0.66# <0.001 AVP 1.09 ± 0.44 4.22 ± 1.27* 2.74 ± 1.18*# 2.10 ± 0.51# <0.001 β1 ADR 1.00 ± 0.49 0.44 ± 0.20* 0.85 ± 0.57# 0.85 ± 0.36# 0.045 β2 ADR 1.00 ± 0.14 0.61 ± 0.27* 0.73 ± 0.29 1.05 ± 0.31# 0.011 NGF 1.02 ± 0.23 0.70 ± 0.39* 1.47 ± 0.65# 1.45 ± 0.59# 0.006 HCN2 1.07 ± 0.46 0.67 ± 0.25* 0.80 ± 0.30 0.99 ± 0.26# 0.038 HCN4 1.01 ± 0.57 1.42 ± 1.46 2.01 ± 0.24* 2.52 ± 0.76*# 0.002 RA ANP 1.00 ± 0.08 1.10 ± 0.84 0.97 ± 0.46 1.01 ± 0.27 0.976 Col 1a1 1.02 ± 0.20 1.98 ± 1.23 2.68 ± 0.95 2.13 ± 1.52 0.160 HCN2 1.02 ± 0.22 0.57 ± 0.46 0.31 ± 0.30* 0.35 ± 0.44* 0.029 HCN4 1.02 ± 0.22 0.74 ± 0.52 0.72 ± 0.29 0.76 ± 0.33 0.533 LA ANP 1.02 ± 0.23 1.45 ± 0.61 0.67 ± 0.34# 0.57 ± 0.30# 0.015 Col 1a1 1.07 ± 0.40 5.09 ± 3.19* 2.34 ± 0.78 2.61 ± 2.02 0.033 HCN2 1.03 ± 0.46 1.86 ± 0.85 1.11 ± 0.52 1.48 ± 0.49 0.172 HCN4 1.01 ± 0.56 0.85 ± 0.57 0.68 ± 0.55 0.62 ± 0.45 0.660
Values were presented as mean ± SD. * p < 0.05 versus the LS group. # p < 0.05 versus the CTL group. The mRNA levels were normalized with an endogenous control (18S rRNA mRNA) and were expressed as arbi-trary units. The values for the LS rats were set at 1.0, and the remaining values were adjusted accordingly. ACE, angiotensin-converting enzyme; ADR, adrenergic receptor; ANP, atrial natriuretic peptide; AVP, arginine vasopressin; β MHC, β-myosin heavy chain; Col1a1, collagen-type Ia; ET-1, endothelin-1; HCN, hyperpolariza-tion-activated cyclic nucleotide-gated channel; LA, left atrium; LV, left ventricle; NGF, nerve growth factor; RA, right atrium; LS, low-salt diet group; CTL, control group; IVA, ivabradine group; BIS, bisoprolol group.
Tyrosine hydroxylase expressions in the LV and atria
Via western blot analysis, the CTL group revealed a significantly reduced expression of TH in the LV, RA, and LA compared with the LS group, which suggested sympathetic nerve dysfunction in the LV and both atria (Figure 4A). A significant recovery in this TH under-expression was observed in the IVA and BIS groups. The representative images of immunofluorescence/immunohistochemical staining to detect TH are shown in Figure 4B and Supplementary Figure 2. The TH positive cell density in the LV, RA, and LA reduced in the CTL group compared with the LS group. These expression levels (innervation) were recov-ered in the IVA and BIS groups.
Figure 4.Tyrosine hydroxylase expression in the cardiac tissues. (A) Quantification of TH protein via western blotting.
(B) Representative images of immunofluorescence staining with anti-TH antibody. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; TH, tyrosine hydroxylase; LS, low-salt group; CTL, control group; IVA, ivabradine group; and BIS, bisoprolol group. The protein levels were expressed relative to the LS group. The scale bar indicates 50 μm. Data were presented as mean ± SD.
DISCUSSION
HR reduction and use of IVA in animals with HF
Prior studies have analyzed that HR reduction with IVA or digoxin prolonged life span in normal
mice (13, 14). They could not determine whether the improved longevity was secondary to HR reduction or to
pleiotropic effects of the drugs per se. The prolonged survival of hypertensive HF animals by chronic IVA therapy is one of the key novel findings in the present study. Although an increase of resting HR is an
inde-pendent prognostic factor of HF and the mechanisms correlating HR and HF are not fully elucidated (15), the
beneficial effects of IVA for HF as shown in the present study may suggest a significant pathophysiological association between HR and HF, as well as the benefits of β-blockers in HF.
Because the decrease in HR lengthens the diastolic filling time, ameliorates the atrioventricular coupling, and decreases myocardial ischemia, it could improve the diastolic filling. Other mechanisms than a simple prolongation of diastolic period in the beneficial effect of IVA on diastolic function have been reported in the animal models. IVA increased the phosphorylation of phospholamban, decreased the N2B isoform
expression of titin and collagen amount, or ameliorated arterial stiffness and endothelial dysfunction (16, 17).
Recently, HR reduction with the use of IVA decreased the period of isovolumic contraction and relaxation both in resting and under dobutamine-stimulated conditions and contributed to favorable LV filling and
preservation of ejection in conscious pigs with LVH induced by hypertension (18). The histological findings in
the improvement of LV fibrosis and myocyte hypertrophy and the restoration of decreased TH expression suggest that the improvement in diastolic properties may be associated with the amelioration of HF and survival benefit in this model.
IVA and SNS in HF
IVA does not modify atrioventricular or intraventricular conduction or myocardial contractility in contrast
to β-blockers (19). Thus, the effects on the autonomic nervous system are presumably different between
them. In the present study, chronic IVA therapy was associated with the amelioration of systemic sympa-thetic activation and the preservation of atrial/ventricular sympasympa-thetic nerve activities. The findings in the telemetry; lower HR in the night-time (active time in rodents) and higher HR in the day-time (sleeping time) in IVA group, may support the strong inhibitory effect on systemic SNS. With regard to the use of β-blocker, the suppressive effects were not observed at a systemic level but at a local cardiac level. The difference may be associated with the findings that IVA does not, but BIS has negative inotropic/lusitropic effects, as sup-ported by the echo data.
Recently, we demonstrated that IVA did not acutely affect sympathetic arterial pressure regulation by
baroreflex, and it also spared the magnitude of the sympathetic HR response in the vagotomized rats (16).
Silva et al. have reported that a 7-day treatment with IVA reduced HR without compromising the
Other human studies have supported the evidence showing that the acute administration of IVA does not
impair sympathetic or parasympathetic baroreflex function (22). The use of β-blockers does not cause
pre-served sympathetic HR response. Thus, these acute effects might lead to chronic effects in the present study, and only the IVA (but not the BIS) group had an amelioration of the systemic sympathetic nerve overactiv-ity, as indicated by urine NAd/normetanephrine excretion.
Analysis of heart rate variability (HRV) is carried out for assessing the cardiac autonomic activity and bal-ance. A reduced HRV, which is characterized by sympathetic overactivity and parasympathetic withdrawal, has been observed in patients with HF, which is in accordance with the severity of HF and the poor
progno-sis (23). Several studies have shown that chronic treatment with IVA in addition to β-blockers improved the
reduced HRV (24, 25). In the present study, decreased TH expressions and NAd contents and decreased ACh
contents in the RAs were restored with IVA treatment, indicating the improvement in local sympathetic and parasympathetic nerve innervations. These findings may be used as a basis in improving HRV in clini-cal studies. Possible mechanisms for the improvement might be as follows: reduced sympathetic stimulation leading to the amelioration of adrenoreceptor-mediated cytotoxicity, apoptosis, and hypertrophy; decreased myocardial oxygen demand and ischemia; and ameliorated diastolic filling and myocardial blood supply by
prolonged diastole period (26). However, the present findings that chronic IVA administration ameliorated
sys-temic sympathetic activation and cardiac sympathetic innervations might be indirect effects or accompanying events.
Pleiotropic actions of IVA in HF
A number of studies have explored the pleiotropic effects of IVA, i.e. cardioprotective effects beyond HR
reduction (27). They include the amelioration of cardiac inflammatory response, antifibrotic, vascular
protec-tive, and antiatherosclerotic effects (28). IVA was reported to reduce myocardial ischemia/reperfusion injury
and to improve the viability of cardiomyocytes (29). Reduced reactive oxygen species (ROS) formation is
sug-gested as a key mechanism. The modulation of the SNS by IVA documented in this study, may be associated with these pleiotropic actions. For example, amelioration of activated SNS might suppress cardiac
inflamma-tion including increased ROS producinflamma-tion in HF (30). Further studies are necessary to examine a direct effect
of IVA on sympathetic/parasympathetic nerve systems and a relationship between sympathetic/parasympa-thetic nerve systems and the pleiotropic actions in IVA treatment.
Study limitation
This study has several limitations. We used a somewhat special HF model of DS hypertensive rats with progressive cardiac and kidney damages. The chronic effects of IVA on sympathetic activity and innervation must be compared with those in other HF models that are not related to hypertension, such as myocardial infarction, myocarditis, and aortic constriction models. Although we showed an improvement in survival
time with the use of IVA and BIS, we did not find any definite difference in the histology or PCR analysis results other than alterations in SNS activation among the two treatment groups. Further analysis must be performed to validate other differences in the mechanisms between IVA and BIS treatments, particularly in terms of LV dysfunction or damage. Moreover, the assessment of the synergistic effects of IVA and β -blocker may be useful in this regard. Lastly, we used light anesthesia with 1.5% isoflurane in echocardiog-raphy. Previous studies have suggested that isoflurane anesthesia may exert modest cardiovascular effects,
such as negative inotropic and lusiotropic effects, and decrease of HR (31).
CONCLUSION
The chronic effects of IVA on sympathetic activity and innervation were assessed and compared with those of β-blockers in hypertensive animals with HF. IVA therapy improved the survival time of the animals without negative inotropic effects, which was mainly associated with the amelioration of systemic sympathetic activation and cardiac sympathetic/parasympathetic innervations, followed by the prevention of progressive myocardial damages and dysfunction. The overall effect was similar to that of chronic β-blocker therapy with negative inotropic effects. However, it had suppressive effects only on the cardiac sympathetic/parasym-pathetic innervations.
Acknowledgments
We would like to thank Kumi Ohmi and Yasumitsu Akahoshi for their technical assistance. Bisoprolol was kindly provided by the Mitsubishi Tanabe Pharma Corporation. This work was supported by a grant-in-aid for scientific research (C) from the Japan Society for the Promotion of Science (16K09465).
Declaration of conflicting interests
REFERENCES
1.Floras JS. Sympathetic nervous system activation in human heart failure:clinical implications of an updated model. J Am Coll Cardiol. 2009;54:375-85.
2.Barrese V, Taglialatela M. New advances in beta-blocker therapy in heart failure. Front Physiol. 2013;4:323.
3.Adamson PB, Gilbert EM. Reducing the risk of sudden death in heart failure with beta-blockers. J Card Fail. 2006;12:734-46.
4.DiFrancesco D, Borer JS. The funny current :cellular basis for the control of heart rate. Drugs. 2007;67 Suppl 2:15-24.
5.Böhm M, Swedberg K, Komajda M, et al; SHIFT Investigators. Heart rate as a risk factor in chronic heart failure (SHIFT):the association between heart rate and outcomes in a randomised placebo-controlled trial. Lancet. 2010;376:886-94.
6.Nikolovska Vukadinović A, Vukadinović D, Borer J, et al. Heart rate and its reduction in chronic heart failure and beyond. Eur J Heart Fail. 2017;19:1230-1241.
7.Watanabe H, Iwanaga Y, Miyaji Y, Yamamoto H, Miyazaki S. Renal denervation mitigates cardiac remodeling and renal damage in Dahl rats:a comparison with β-receptor blockade. Hypertens Res. 2016;39:217-26.
8.Inoko M, Kihara Y, Morii I, Fujiwara H, Sasayama S. Transition from compensatory hypertrophy to dilated, failing left ventricles in Dahl salt-sensitive rats. Am J Physiol. 1994;267:H2471-2482.
9.Fang Y, Debunne M, Vercauteren M, et al. Heart rate reduction induced by the if current inhibitor ivabradine improves diastolic function and attenuates cardiac tissue hypoxia. J Cardiovasc Pharmacol. 2012;59:260-7.
10.Colan SD, Borow KM, Neumann A. Left ventricular end-systolic wall stress-velocity of fiber shortening relation :a load-independent index of myocardial contractility. J Am Coll Cardiol. 1984;4:715-24.
11.Watson LE, Sheth M, Denyer RF, Dostal DE. Baseline echocardiographic values for adult male rats. J Am Soc Echocardiogr. 2004;17:161-7.
12.Shimizu S, Akiyama T, Kawada T, et al. Medetomidine suppresses cardiac and gastric sympathetic nerve activities but selectively activates cardiac vagus nerve. Circ J. 2014;78:1405-13.
13.Gent S, Kleinbongard P, Dammann P, Neuhäuser M, Heusch G. Heart rate reduction and longevity in mice. Basic Res Cardiol. 2015;110:2.
14.Coburn AF, Grey RM, Rivera SM. Observations on the relation of heart rate, life span, weight and mineralization in the digoxin-treated A-J mouse. Johns Hopkins Med J. 1971;128:169-93.
15.Ma Y, Chilton RJ, Lindsey ML. Heart rate reduction:an old and novel candidate heart failure therapy. Hypertension. 2012;59:908-910.
16.Reil JC, Hohl M, Reil GH, et al. Heart rate reduction by If-inhibition improves vascular stiffness and left ventricular systolic and diastolic function in a mouse model of heart failure with preserved ejection fraction. Eur Heart J. 2013;34:2839-49.
17.Maczewski M, Mackiewicz U. Effect of metoprolol and ivabradine on left ventricular remodelling and Ca2+ handling in the post-infarction rat heart. Cardiovasc Res. 2008;79:42-51.
18.Rienzo M, Melka J, Bizé A, et al. Ivabradine improves left ventricular function during chronic hypertension in conscious pigs. Hypertension. 2015;65:122-129.
19.DiFrancesco D, Camm JA. Heart rate lowering by specific and selective I(f)current inhibition with ivabradine:a new therapeutic perspective in cardiovascular disease. Drugs. 2004;64:1757-65.
20.Yamamoto H, Kawada T, Shimizu S, et al. Ivabradine does not acutely affect open-loop baroreflex static characteristics and spares sympathetic heart rate control in rats. Int J Cardiol. 2018;257:255-261.
21.Silva FC, Paiva FA, Müller-Ribeiro FC, et al. Chronic Treatment with Ivabradine Does Not Affect Cardiovascular Autonomic Control in Rats. Front Physiol. 2016;7:305.
22.Heusser K, Tank J, Brinkmann J, et al. Preserved Autonomic Cardiovascular Regulation With Cardiac Pacemaker Inhibition :A Crossover Trial Using High-Fidelity Cardiovascular Phenotyping. J Am Heart Assoc. 2016;5. e002674.
23.Bilchick KC, Fetics B, Djoukeng R, et al. Prognostic value of heart rate variability in chronic congestive heart failure (Veterans Affairs’ Survival Trial of Antiarrhythmic Therapy in Congestive Heart Failure). Am J Cardiol. 2002;90:24-8.
24.Kurtoglu E, Balta S, Karakus Y, et al. Ivabradine improves heart rate variability in patients with nonischemic dilated cardiomyopathy. Arq Bras Cardiol. 2014;103:308-14.
25.Böhm M, Borer JS, Camm J, et al. Twenty-four-hour heart rate lowering with ivabradine in chronic heart failure:insights from the SHIFT Holter substudy. Eur J Heart Fail. 2015;17:518-26.
26.Fang Y, Debunne M, Vercauteren M, et al. Heart rate reduction induced by the if current inhibitor ivabradine improves diastolic function and attenuates cardiac tissue hypoxia. J Cardiovasc Pharmacol. 2012;59:260-7.
27.Heusch G, Kleinbongard P. Ivabradine:Cardioprotection By and Beyond Heart Rate Reduction. Drugs. 2016;76:733-40.
28.Schirmer SH, Degen A, Baumhäkel M, et al. Heart-rate reduction by If-channel inhibition with ivabradine restores collateral artery growth in hypercholesterolemic atherosclerosis. Eur Heart J. 2012;33:1223-31.
29.Kleinbongard P, Gedik N, Witting P, Freedman B, Klocker N, Heusch G. Pleiotropic, heart rate-independent cardioprotection by ivabradine. Br J Pharmacol. 2015;172:4380-90.
30.Deo SH, Fisher JP, Vianna LC, et al. Statin therapy lowers muscle sympathetic nerve activity and oxidative stress in patients with heart failure. Am J Physiol Heart Circ Physiol. 2012;303:H377-85. 31.Stein AB, Tiwari S, Thomas P, et al. Effects of anesthesia on echocardiographic assessment of left
Supplementary Figure 2.Histology of the left ventricle and atria
(A)Representative images of the LV myocardial sections stained with Masson’s trichrome and the quantitative analyses of myocyte cell diameter and fibrotic area. (B) Representative images of the atria with Masson’s trichrome. (C) Representative images of immunohistochemical staining with anti-TH antibody with higher magnification. TH, tyrosine hydroxylase; LS, low-salt group; CTL, control group; IVA, ivabradine group; BIS, bisoprolol group. The values were presented as mean ± SD.
Supplementary Table.The oligonucleotide primers for quantitative real-time RT-PCR
Genes Forward Primers Reverse Primers
ACE AAAGCTGCGAAGGATCATCG TTGCCGGTGGAGTAGATTCTG
β1 ADR TGTGAGCTCTCTGGACTTCGGTA TGGTGACGAAATCGCAGCACT
β2 ADR TGGTGCGAGTTCTGGACTTCCA GTGAAGAAGTCACAGCAAGTCT
ANP GATCTGCCCTCTTGAAAAGCA TGGCTGTTATCTTCGGTACCG
AVP CTCGCCATGATGCTCAACACT TGTCTCAGCTCCATGTCGGAT
Col 1a1 ACGCATGGCCAAGAAGACATC TTTGCATAGCACGCCATCG
ET-1 CTTCTGCCACCTGGACATCAT TCCCTTGGTCTGTGGTCTTTG
HCN2 GCGTGGACAACTTCAACGAG GAACACACCCGAGCTGAGAT
HCN4 AGGGCAACAAGGAGACCAAG AGTGAGTAGAGGCGGCAGTA
NGF CGCAGCGTCATGCAGAAGTA CAGGTAGAAGTCCCGGAAAAGC
β MHC CTACAGGCCTGGGCTTACCT TCTCCTTCTCAGACTTCCGC
18S rRNA AGTCCCTGCCCTTTGTACACA CGATCCGAGGGCCTCACTA
ACE, angiotensin-converting enzyme; ADR, adrenergic receptor; ANP, atrial natriuretic peptide; AVP, arginine vasopressin; Col 1a1, collagen-type Ia; ET-1, endothelin-1; HCN, hyperpolarization-activated cyclic nucleotide-gated channel; NGF, nerve growth factor; β MHC, β-myosin heavy chain.