Study Design:The physical states of HPV‑16 in cervical cancer cell lines were ascer- tained by long and accurate polymerase chain reaction(LA‑PCR)

(1)

CHARACTERIZATION OF HPV‑16 INTEGRATION IN CERVICAL CANCER CELLS USI NG LONG AND

ACCURATE PCR (LA‑PCR)

Yoichiro Suzuki

(Received 16 March 2004,Accepted 6 May 2004) Department of Obstetrics and Gynecology, Akita University School of

Medicine, Akita 010‑8543, Japan

Abstract

Objective:The aim of present study is to clarify HPV‑16 integration in cervical cancer cells using a novel PCR‑based strategy.

Study Design:The physical states of HPV‑16 in cervical cancer cell lines were ascer- tained by long and accurate polymerase chain reaction(LA‑PCR). HPV‑16 integration in these cells was examined with a PCR‑based protocol.

Results:Using LA‑PCR to detect a series of viral and flanking cellular sequences,the sites of viral integration were precisely det ermined. All viral copies were integrated and disrupted one or more chromosomal regi on in CaSki cells. Although open reading frames E6/7 were preferentially conserved i n the cells,there was no other obvious preference for the sites of integration. Thi s LA‑PCR‑based protocol was useful for determining the sites of viral integration not only in cell lines but also in clinical cancer samples.

Conclusion:The method described in this report can precisely detect HPV integration using a small amount of DNA. Its applicat ion to precancerous cervical lesions may lead to early identification of patients at high ri sk for malignant transformation of cervical lesions.

Key words:HPV,Integration,SiHa cell,CaSki cell

Introduction

Human papillomaviruses(HPVs)are small, double‑stranded DNA viruses that infect epithelial cells and cause a variety of skin and mucocutaneous lesions. Approximately 100 different genotypes of HPV have been identified to date,and nearly 30 are known to be associated wi th lesions of the anogenital tract. Infect ion with specific types of HPV (HPV‑16,‑18,and s everal others)is a well‑ established risk factor for the development of cer-

vical carcinoma .

HPV infection of uterine cervix epithelial cells is followed by transfer of t he virus to the host cell nuclei. Viral DNA exists in two different forms in host cells:episomal and i ntegrated. Integration occurs when the original ci rcular viral genomes are disrupted at one or more sites and integrated into host cellular chromosomes . Benign and early‑

stage cervical lesions contain viral DNA as episomes,but approximat ely 80% of cancerous lesions contain integrated viral DNA . Viral integration results in increased expression and stabil- ity of two viral transforming genes,E6 and E7.

―185―

( )19

Akita J Med 31:185‑193,2004

博士論文（平成 10年学位授与）

(2)

The products of these viral genes can immortalize human keratinocytes or i nactivate human anti‑ oncogenes,p53 and Rb . Thus,integration of HPV into human chromos omes is thought to be a key step in the process of cervical carcinogenesis .

The integration of HPV genomes appears to occur frequently at speci fic sites including the E2 open reading frame(ORF) . In general,the disruption of E1/2 open readi ng frames during HPV integration appears to play an important role in the malignant transformation of the cervix following HPV infection. However ,the molecular events of viral integration and the mol ecular events leading to malignant transformat ion have not been clearly identified.

Viral episomes and integrated viral genomes appear to coexist in clini cal cervical lesions . Consequently,the amplification of integrated viral and flanking cellular sequences is required to dem- onstrate viral integration. For specific and sensi- tive detection of viral integration,we adopted a new protocol based on long and accur ate polymerase

chain reaction(LA‑PCR). Primers were designed based on the HPV16 E6 and Alu sequences,which is interspersed in human DNA wi th a copy number of roughly 750,000,and with a mean interval of approximately 4 kb . This strategy enables us to detect HPV integration using ampl ification between HPV and Alu sequences.

Materials and methods Cell lines and culture conditions

The Human cervical cancer cell lines SiHa and CaSki were obtained fr om the American Type Culture Collection(Rockvi lle, MD, USA)and routinely cultured as adher ent monolayers at 37°C in Dulbeccoʼs modified Eagleʼ s medium (DMEM)sup- plemented with 10% fetal bovine serum (FBS)and in a humidified atmospher e containing 5% CO .

DNA extraction

DNA from cultured cells was isolated according to van den Brule et al. . Briefly,the cells were Characterization of HPV‑16 integration in cervical cancer cells

Fig.1 Location of primers in the HPV16 genome

Each primer is indicated wi th an arrow along with its nucleotide position in the HPV genome.

( )20

(3)

digested at room temperature with 100 mg/ml of proteinase K in 50 mM Tr is‑HCl,pH 8.2,containing 10 mM EDTA and 2% SDS. Af ter a two‑step phenol‑chloroform extract ion,DNA was collected by ethanol precipitation. Ext racted genomic DNA was dissolved in TE buf fer(10 mM Tris‑HCl,pH 8.0,1 mM EDTA)and us ed as templates in the following PCR analysis.

LA‑PCR

Several regions of HPV 16 DNA were amplified by a LA‑PCR technique t o determine the viral form in SiHa and CaSki cells,i ncluding the disruption of E1/2 ORFs. HPV 16 oligonucl eotide primers were designed corresponding t o HPV16 E6,E7,E1,E5 and L1 ORFs. The locat ions of each primer in the HPV16 genome are shown i n Fig.1,and their nu- 秋田医学

Table 1 Nucleotide sequences of the primers HPV16 E6 primers

Name Nucleotide sequence(5′to 3′) E6 Forward(121‑150) GGAGCGACCCAGAAAGTTACCACAGTTATG E6 Forward(215‑240) CTGCGACGTGAGGTATATGACTTTGC

E6 Reverse(103‑132) CTGGGTCGCTCCTGTGGGTCCTGAAACATT

HPV16 E7 primers

Name Nucleotide sequence(5′to 3′) E7 Forward(606‑630) GCAACCAGAGACAACTGATCTCTAC E7 Forward(736‑765) TGCAAGTGTGACTCTACGCTTCGGTTGTGC

E7 Reverse(780‑805) GGTCTTCCAAAGTACGAATGTCTACA

HPV16 E1 primer

Name Nucleotide sequence(5′to 3′) E1 Forward(2155‑2184)ATAGGGTAGATGATGGAGGTGATTGGAAGC

HPV16 E5 primer

Name Nucleotide sequence(5′to 3′) E5 Reverse(3867‑3896) CAAAAAGCACGCCAGTAATGTTGTGGATGC

HPV16 L1 primers

Name Nucleotide sequence(5′to 3′) L1 Forward(5677‑5706)CTCCTGTCCCAGTATCTAAGGTTGTAAGCA

L1 Reverse(7095‑7124) TGTAGAGGTAGATGAGGTGGTGGGTGTAGC

Alu primers

Name Nucleotide sequence(5′to 3′) Alu Reverse(169‑198) CGATCCTCCTGCCTCAGCCTCCCGAGTAGC

Alu Reverse(121‑150) CCACCACGCCCGGCTAATTTTTGTATTTTT

HPV and Alu primers are based on the complete sequence of HPV16(GenBank accession no.K02718)and the Alu‑J cons ensus sequence(GenBank accession no.

U14567).

―187―

( )21

(4)

cleotide sequences are presented in Table 1. LA‑

PCR amplification was performed with several pairs of HPV16 primers. The reactions were carried out in a final volume of 50μl containing 500 ng of DNA,1X LA‑PCR Buf fer II(TAKARA,Tokyo, Japan),2.5 mM MgCl,0.4 mM dNTPs,0.2μM HPV primers(forward and reverse)and 1.25 U of Taq polymerase(TaKaRa LA Taq,TAKARA) and carried out in a GeneAmp PCR System 2400 (PerkinElmer Instruments,MA,USA). Cycling conditions consisted of an initial denaturation for 1 min at 94°C,followed by 30 cycles of denaturation for 15 sec at 98°C and anneal ing/extension for 10 min at 68°C. The Hot St art method using an anti‑ Taq polymerase antibody(TaqStart Antibody;

Clontech Laboratories,Inc.,Palo Alto,USA)was applied to all reactions t o decrease non‑specific amplification.

HPV16‑Alu LA PCR

To detect the integration of HPV16 genomes, LA‑PCR was performed with primers corresponding to the HPV16 E6 ORF and the Alu sequence.Alu primers were designed bas ed on the Alu‑J consensus sequence. There are ei ght subfamilies of Alu repeats,and each primer has＞90% homology to the other members of the s ubfamily. The locations of the HPV16 primers ar e shown in Fig.2,and the nucleotide sequences are pr esented in Table 1.

The reactions were carried out in a final volume of 50μl containing 100 ng of DNA,1X LA‑PCR Buffer II(TAKARA), 2. 5 mM MgCl, 0.4 mM dNTPs,0.5μM HPV pri mer,0.002μM Alu primer and 1.25 U of Taq polymer ase(TaKaRa LA Taq) using a GeneAmp PCR System 2400. Primer sets used in each reaction wer e E6 F(121‑150)/Alu R (169‑198)in the first PCR and E6 F (215‑240)/Alu R(121‑150)in the second PCR. Cycl ing conditions consisted of an initial denaturation for 1 min at 94°C,followed by 25 cycl es of denaturation for 15 sec at 98°C and annealing/ext ension for 15 min at 68°C. A 1μl sample of t he first PCR product was subjected to a second PCR ampl ification using an initial denaturation for 1 mi n at 94°C,followed by 25

cycles of denaturation for 15 sec at 98°C and annealing/extension for 10 min at 68°C. The Hot‑Start method was applied to al l reactions.

Southern hybridization analysis

The amplificat ion product corresponding to the HPV16 E7 region［E7 F(606‑630)/E7 R(780‑805)］

was cloned into the pCR II vector(Invitrogen Cor- poration,San Diego,USA)with the TA cloning method using an Origi nal TA Cloning Kit (Invitrogen Corporation)according to the manu- facturerʼs instructions. The identity of the insert was confirmed by cycle s equencing. The cloned HPV E7 sequence was i dentical to the known E7 sequence. Purified plasmi d DNA was subjected to PCR［E7 F(606‑630)/E7 R(780‑805)］, and a Digoxigenin(DIG)‑11 dUTP‑l abeled DNA probe was prepared using the PCR DI G Labeling Mix (Roche Diagnostics Corporation, Indianapolis, USA)according to the manufacturerʼs instructions. The products of the second HPV16‑Alu LA‑PCR products were separated on 0.8% agarose gels and transferred to nylon membr anes(Hybond N＋ ; Amersham International PLC,Bucks,England).

The membranes were incubated with the DIG‑

labeled genomic probe for 12 h and washed twice for 5 min at room temperatur e in 2X SSC‑0.1% SDS, followed by a 15 min wash at 42°C in 0.1X SSC‑0.1%

SDS. The hybridized probes were detected using the DIG Nucleic Acid Det ection Kit(Roche Diag- nostics Corporation).

Results

LA‑PCR analysis in cervical cancer cell lines LA‑PCR amplifications with each different pair of HPV primers were car ried out to confirm the existence of each ORF in t he HPV 16 genome(Fig.

2,3). The amplification product corresponding to L1‑URR‑E6‑E7(Reaction A)was obt ained in both SiHa and CaSki cel ls,whereas the product corresponding to E1/2 s equences(Reaction B/C) was found only in CaSki cells. These results sug- gest that E1/2 ORFs are disrupted in SiHa cells, ( )22 Characterization of HPV‑16 integration in cervical cancer cells

(5)

which have one copy of HPV as previously report- ed . In addition,the E1/2 ORF sequences are conserved in at least some vi ral copies in CaSki cells. Consequently,exami nation of only E2 disruption in HPV genomes is not enough to demon- strate HPV integration. Furthermore,although the amplification product s corresponding to E1‑E2‑

E5‑L2‑L1‑URR‑E6‑E7,L1‑URR‑E6‑E7‑E1‑E2‑E5 and E6‑E7‑E1‑E2‑E5‑L2‑L1 s equences(Reaction D,E,F,respectively)wer e all obtained,only the product corresponding to t he E7‑E1‑E2‑E5‑L2 L1‑

URR‑E6 sequence(Reaction G)was not unrecognized in CaSki cells. The unrecognized sequence was amplified in the CIN I sample. Therefore,it appears that all HPV16 copi es are disrupted at a

site other than E6/7 ORFs and exist in an integrated state in CaSki cells. Thus ,amplification of both viral and cellular sequences i s necessary for the strict elucidation of the HPV i ntegration.

HPV16‑Alu LA PCR analysis in cervical cancer cells

To detect HPV16 integrations in cervical cancer cells, we carried out HPV16‑Al u LA PCR amplification with primer s corresponding to HPV16 E6 ORF and Alu repeats. The validity of the LA‑

PCR products was confirmed by Southern blotting with a HPV E7 probe. A s ingle product hybridized to the HPV E7 probe in Si Ha cells after HPV16‑Alu LA‑PCR amplification,wher eas multiple strongly

Fig.2 LA‑PCR analysis in SiHa and CaSki cells

DNA extracted from SiHa and CaSki cells was subjected to LA‑PCR amplification with each pair of HPV primers. The outline of each reaction is summar ized as schemata(Reactions A,B and C). A 3μl portion of the amplified PCR products were s eparated on a 0.6% Agarose gel(lanes A,B and C).

Lambda DNA digested with HindIII was run in lane M as a molecular weight marker. The products with the appropriate sizes were not obtained in React ions B and C in SiHa cells.

―189―

( )23 秋田医学