CHAPTER 4 A simple LAMP detection of Phytophthora colocasiae in infected taro fields
4. Detection of the pathogen in field samples
To identify the most efficient plant LAMP procedure for use in the field, we compared PC-LAMP, P-LAMP (with heat treatment), and PE-LAMP (see Materials and Methods for details) (Fig. 4-2). A total of 35 diseased leaf samples were collected from 17 fields in Chiba and Ehime prefectures and tested with the three methods. These assays were
85
monitored using the turbidity of the reaction mixture. Phytophthora colocasiae was found in 29 samples using PC-LAMP, 32 samples using P-LAMP, and 33 samples using PE-LAMP (Table 4-4). One sample from Shikokuchuo-2, Ehime prefecture gave no positive results with any of the three methods. Two samples in Shikokuchuo-1 that gave positive results with PC-LAMP gave negative results with P-LAMP, and one of these also gave a negative result with PE-LAMP. No colonies grew from five of the diseased samples from Chiba prefecture, and this resulted in negative results with the PC-LAMP assay, even though the pathogen was detected in the same samples by P-LAMP and PE-LAMP.
We repeated the P-LAMP assays with the same diseased samples, using SYBR Green I dye instead of turbidity to detect the presence of the pathogen. In this case, orange or brown represented no reaction and yellow-green represented a positive reaction. The same numbers of samples showed positive results as those monitored by turbidity (Fig.
4-3). To confirm the positive results, all isolates were recovered from the NARM medium and identified by morphological characteristics as P. colocasiae.
86
Fig. 4-1. Specificity (a) and sensitivity (b) of the LAMP reaction. (a) The LAMP reaction was performed using the primers shown in Table 4-5 with genomic DNA from Phytophthora colocasiae and 16 closely related Phytophthora species. Progress of the reactions was monitored in real time using a turbidimeter. (b) A serial dilution of P.
colocasiae genomic DNA was used to test the sensitivity of the LAMP primers.
-0.1 0.1 0.3 0.5 0.7 0.9
0 6 12 18 24 30 36 42 48 54 60
Tu rb id ity
Time (min)
1 ng 100 pg 10 pg 1 pg 100 fg 10 fg 1 fg Blank -0.1
0.1 0.3 0.5 0.7 0.9
0 6 12 18 24 30 36 42 48 54 60
Tu rb id ity
Time (min)
P. colocasiae P. capensis
P. citricola P. elongata
P. pini P. plurivora
P. frigida P. multivora
P. multivesiculata P. himalsilva P. citrophthora P. botryosa
P. meadii P. capsici
P. tropicalis P. mengei
P. siskiyouensis Blank
(a)
(b)
87
)LJ$W\SLFDOGLVHDVHGWDUROHDIVKRZLQJSDUWVRIGLVHDVHGWLVVXHVWKDWZHUHVDPSOHG IRU3ODQW&XOWXUH/$03żDQGDERXWFPGLVHDVHGWLVVXHVVDPSOHGIRU3ODQW/$03
RU3ODQW([WUDFWLRQ/$03տ
88
Fig. 4-3. Identification of Phytophthora colocasiae in 35 leaf samples with P-LAMP and color detection using SYBR Green I. The samples were collected from three regions of Chiba prefecture and two regions of Ehime prefecture. In samples with no amplification of P. colocasiae DNA, the SYBR Green I remains brown/orange, whereas in samples with positive amplification the dye turns yellow-green. PC: positive control, NC: negative control.
PC NC
Chiba; Yachimi-Shiki
Chiba; Yachimi-Oki Chiba; Chiba
Ehime; Shikokuchuo-1 Ehime; Shikokuchuo-2
89
Table 4-1. Isolates of Phytophthora, Pythium, Phytopythium, and other soil-borne oomycetes used in this study, with amplification results from LAMP assays using the primers shown in Table 4-5
Species Cladea Isolateb Origin Amplificationc
Phytophthora nicotiane 1 CBS 535.92 Kalanchoe
-P. cactorum 1a MAFF731066 Strawberry
-P. tentaculata 1b C05 Gazania sp.
-P. infestans 1c MAFF236324
-P. capensis 2 CBS 128319
-P. citricola 2 P0713 Eustoma grandiflorum
-P. elongata 2 CBS 125799 Eucalyptus marginata
-P. pini 2 CBS 18125 Pinus resinosa
-P. plurivora 2 CBS 124093 Soil
-P. frigida 2 CBS 121941 Eucalyptus smithii
-P. multivesiculata 2 CBS 545.96 Cymbidium
-P. multivora 2 NBRC31016
-P. botryosa 2a CBS 58169
-P. citrophthora 2a CBS 950.87 Zingiber officinale
-P. colocasiae 2a NBRC30695 Colocasia antiquorum +
MS28041 Colocasia antiquorum + EPC201522 Colocasia antiquorum + EPC2017KO1 Colocasia antiquorum +
P. himalsilva 2a CBS 128767 Soil
-P. meadii 2a CBS 219.88
-P. capsici 2b MAFF305920 Water melon
-P. siskiyouensis 2b CBS122799 Alnus incana
-P. tropicalis 2b CBS 43491 Albizia julibrissin
-P. mengei 2b 42B2 Avocado
-P. nemorosa 3 C71
-P. palmivora 4 CH88-1 Oncidium
-P. heveae 5 P1102
-P. humicola 6a P3826
-P. megasperma 6b NBRC32176 White trumpet lily
-P. asparagi 6c CBS 132095
-P. cambivora 7a MAFF305918 Apple
-P. cajani 7b P3105
-P. cryptogea 8a CBS 113.19 Anaphalis margaritacea
-P. erythroseptica 8a CBS 129.23 Potato
-P. sansomeana 8a CBS 117692 Silene latifolia
-P. brassicae 8b CBS 179.87 Brassica oleracea
-P. dauci 8b CBS 127102 Carota
-P. foliorum 8c CBS 121655 Azalea sp.
-P. lateralis 8c CBS 168.42 Lawson cypress
-P. syringae 8d Fium1
-P. insolita 9 P6195 Soil
-P. kernoviae 10 P1751
-90
Table 4-1. Continued
aMolecular phylogenetic clades for Pythium and Phytophthora were obtained from Lévesque and De Cock (2004) and Blair et al. (2008), respectively.
b Isolates were collected from the CBS-KNAW Fungal Biodiversity Centre (CBS), the NITE Biological Research Centre (NBRC), the NIAS Genebank (MAFF), the World Phytophthora Genetic Resource Collection (P), and the Gifu University Cultures Collection.
c Symbols: + = amplified, – = no amplification based on turbidity measurements
Pythium adhaerens A CBS 520.74 Soil
-Py. arrhenomanes B1 NBRC100102 Zoysia grass
-Py. dissotocum B2 MAFF305576 Soil
-Py. acanthicum D MAFF241099 Soil
-Py. hypogynum E1 CBS 234.94 Soil
-Py. middletonii E2 CBS 528.74 Soil
-Py. irregulare F CBS 263.30 Nicotiana tabacum
-Py.spinosum F NBRC100116 Carrot field soil
-Py. paddicum G MAFF241108 Water
-Py. anandrum H CBS 285.31 Rheum rhaponitium
-Py. ultimum I NBRC100122 Sugar beet
-Py. polymastum J CBS 811.70 Lettuce
-Phytopythium chamaehyphon CBS 259.30 Papaya
-Pp. helicoides NBRC100107 Rose
-Pp. oedochilum GUCC0829 Yacon
-Pp. ostracodes CBS 768.73 Soil
-Pp. vexans 2D111 Soil
-Aphanomyces sp. GFHT2
-Fusarium oxysporum MAFF72510 Strawberry
-Plasmodiophora brassicae HY Chinese cabbage
-Plasmodiophora brassicae AH
-Rhizoctonia solani SO1 Bacopa
-Saprolegnia sp. IFO32708 Brown trout
-Vertivillium alboatrum Vaal Potato
-Scierotinia sclerotiorum AiTog Wax gourd
-91
Table 4-2. Specific identification of Phytophthora colocasiae among isolates maintained on selective media using Plant Culture-LAMP
Species isolate Amplificationa
(PC-LAMP)
P. colocasiae P6317 +
MS28041 +
Kagoshima isolates + (47/47)b
Miyazaki isolates + (5/5)b
P. capensis CBS128319 -
P. pini CBS18125 -
P. botryosa CBS58169 -
P. citrophthora CBS95087 -
P. himalsilva CBS128767 -
P. meadii CBS 21988 -
P. siskiyouensis CBS122799 -
P. tropicalis CBS 43491 -
a For Plant Culture-LAMP (PC-LAMP), the diseased samples were placed on a selective medium and incubated for 2–3 days, then the medium was mixed with water and used for amplification. Symbols: + = amplified, – = no amplification based on turbidity measurements.
b Number of amplified isolates/Number of tested isolates.
92
Table 4-3. Comparison of two Plant-LAMP approaches, one with and one without heat treatment of the plant-water suspension
Samples tested
Total number of samples
Number of samples with positive resultsa P-LAMP
(without heat treatment)
P-LAMP (with heat treatment)
PC-LAMP
Uninoculated 10 8 0 Nb
Inoculated 10 10 10 10
a For Plant-LAMP (P-LAMP), leaf tissues were mixed with distilled water and the supernatant was used directly for amplification. We tested this method with and without heating the plant-water suspension to 98°C for 8 minutes before amplification. For Plant Culture-LAMP (PC-LAMP), the leaf tissues were placed in a culture medium and incubated for 2–3 days, then the medium containing mycelium was mixed with water and used for amplification.
b N, no mycelial growth.
93
Table 4-4. Detection of Phytophthora colocasiae in field samples using three LAMP methods
Location Number
of fields
Number of samples
Number of positive samplesa
PC-LAMPb P-LAMP
(with heat treatment) PE-LAMP
Chiba
Yachimi-Shiki 4 12 7 12 12
Yachimi-Oki 3 3 3 3 3
Chiba 8 9 9 9 9
Ehime Shikokuchuo-1 1 6 6 4 5
Shikokuchuo-2 1 5 4 4 4
Total 17 35 29 32 33
a For Plant Culture-LAMP (PC-LAMP), the leaf tissues were placed in a culture medium and incubated for 2–3 days, then the medium containing mycelium was mixed with water and used for amplification. ForPlant-LAMP (P-LAMP) with heat treatment, leaf tissues were mixed with distilled water and the plant-water suspension was heated to 98°C for 8 minutes before the supernatant was used for amplification. For Plant Extraction-LAMP (PE-LAMP), DNA was extracted from diseased leaf tissues using the Kaneka Easy DNA Extraction Kit version 2 and then used for amplification.
b For PC-LAMP, here was no colony growth in five samples that gave negative results.
94
Table 4-5. The primers selected in this study
Target species Primers Sequences (5’- 3’) Region
amplified
P. colocasiae
PhyCol_F3 GGACTTTGTGAGTTTCAG
Ypt1
PhyCol_FIP CTAGAGAATACCACCAAGTC
ATGAAGAGGTCCTGTGAGGT
PhyCol_B3 CCACGGTAGTAGCTGCTAGT
PhyCol_BIP GTTGTGCCAACTCCCTTGTG
AATCGTGCGGAAACGCTC
PhyCol_LB CTCCTGTAGTGGGACACGG
PhyCol_LF GCAATCCTGATAGA
95
DISCUSSION
In this study, we explored the use of the LAMP method for detection and identification of P. colocasiae. We designed primers that were specific for this pathogen and highly sensitive, with a detection limit of 100 fg. Nath et al. (2014) designed three sets of PCR primers for the specific amplification of P. colocasiae. The detection limits of those primers were 50 pg of pure DNA in conventional PCR and 12.5 fg in real-time PCR.
However, LAMP has some advantages over PCR in terms of simplicity, rapidity, and low-cost. Skilled personnel are not needed to perform the LAMP assay. Therefore, we feel that the LAMP method is a suitable approach for analyzing the pathogen in the field.
Many research studies, such as analyses of mating-type distribution or population structure analyses, require the collection of large numbers of isolates from many sources.
Usually the isolates are collected using selective media, however, there is a high risk mis-identification with this approach because the long-term maintenance, transplantation, and transportation of an isolate can easily lead to contamination with non-target species.
Hence, the re-identification of each isolate becomes necessary. Sequence analyses or detailed morphological analyses are complex and time-consuming. In this study we explored the simple PC-LAMP method, which involves the short-term culture of the target species on selective media. Our results indicate that this method is very effective for the rapid and simple identification of the target species.
The LAMP method does not require the extraction and purification of DNA for detection of pathogens in plant materials. Feng et al. (2018a) used the P-LAMP method for the sensitive detection of pathogens in lettuce samples. In this study, we compared two approaches of P-LAMP: one with, and one without heat treatment for detection of P.
96
colocasiae in inoculated and uninoculated tissues of taro leaves that had been inoculated with the pathogen. False positive results were found by the latter approach; however, no false positive results were obtained by the former approach. It is possible that some ingredient(s) in the taro leaves caused turbidity in the LAMP assays, and that the heat treatment effectively eliminated this negative result.
To identify the most effective and dependable method for the on-site detection of P.
colocasiae in taro fields, we compared three methods: PC-LAMP, P-LAMP with heat treatment, and PE-LAMP by testing them with 35 diseased leaf samples collected in the field. One sample from Shikokuchuo-2, Ehime prefecture gave negative results with all three methods, suggesting that the disease in this sample was not caused by P. colocasiae.
Five samples gave false negative results with the PC-LAMP method. These five leaves were held in cold storage at 4°C for two weeks before the assays were conducted.
Phytophthora colocasiae survives as mycelium in plant tissues or as encysted zoospores in soil (Brooks 2005). Hence, it was most likely that P. colocasiae in the samples had died during the cold storage period and was unable to grow colonies in the selective media.
Unconsidering these five leaves with human error, the total percentage of coincidental results between PC-LAMP and P-LAMP / PE-LAMP was 93.33% / 96.67% with a total Cohen’s Kappa value of 0.47 / 0.65 and a BAK index of 0.46 / 0.65. These results showed a moderate /substantial agreement (Cohen 1960; Landis and Koch 1977; Byrt et al. 1993).
Two samples in Shikokuchuo-1 that gave positive results with PC-LAMP gave negative results with P-LAMP or PE-LAMP. These two samples each had only a few indistinct lesions, and this may explain the false negative results with P-LAMP and PE-LAMP. Such false negative results may be avoided by testing multiple 0.5 cm2 tissue samples from such indistinct diseased leaves. The methods of P-LAMP and PE-LAMP showed similar
97
detection capacity in the 35 samples, with a total percentage of coincidental results of 97.14%, a total Cohen’s Kappa value of 0.79 and a BAK index of 0.79. Although P-LAMP had a slightly lower sensitivity than PC-P-LAMP and PE-P-LAMP, it was nevertheless found to be suitable for diagnosis of P. colocasiae in taro cultivation fields due to its simplicity, dependability, and especially, no extra time and cost. We also demonstrated that the color assay with SYBR Green I dye is effective for detection in the field samples with the P-LAMP method.
We also used LAMP assays to investigate the soil in infected fields, testing three DNA extraction kits that are often used for soil samples. However, it was very difficult to detect P. colocasiae in the soil samples even with the most effective kit (data not shown). Other researchers have also been unable to detect P. colocasiae oospores in soils or naturally infected host tissues, although P. colocasiae A1 and A2 types have occasionally been found to coexist in some areas (Ko 1979; Zhang et al. 1994). Because oospores have rarely been found in soils, the zoosporangia might be the most important survival structure, even though they have lower viability (Lin and Ko 2008; Quitugua and Trujillo 1998). Gollifer et al. (1980) reported that P. colocasiae zoosporangia survived for less than 21 days in naturally infested soils. However, Quitugua and Trujillo (1998) found the zoosporangia survived for more than 107 days in soils at –1,500 J/kg matric potential.
Gómez (1925) reported that zoosporangia can last in taro leaves for 3 months. Thus, further research is needed to investigate the survival structures of P. colocasiae in the soil, and to develop more sensitive LAMP detection methods for detecting the pathogen in soil samples.
In conclusion, a LAMP primer set for detection of P. colocasiae with a specificity and sensitivity of 100 fg was designed. We have demonstrated that the PC-LAMP and
P-98
LAMP methods can be used to simply, effectively, and dependably identify P. colocasiae in agar media or taro fields. These methods have the potential to greatly enhance the management and prevention of the disease in the field.
99
OVERALL DISCUSSION
Plant pathogenic oomycetes cause many kinds of serious devastating diseases to various plants. These diseases have a rapid morbidity cycle, could easily spread to the surrounding environment with the movement of zoospore in water, resulting in a large area of crop getting a devastating loss. Once crop infested by plant pathogens, it may become a carrier and facilitate further spread of diseases. So there is a need for early diagnosis by a technique for detecting the plant pathogens from the plant and soil with a short time in agricultural field for disease prevention and control. The current “gold standard method” of detection of oomycetes uses conventional PCR and real-time PCR, but there are still some disadvantages, such as the need to use a thermal cycler for the reaction, the multiple and complex operation process and high-purity extraction of DNA (Mori et al. 2001; Tomita et al. 2008). Because of requiring only a constant temperature and crude DNA, LAMP assay was chosen as the simple and rapid method for detection of plant pathogens.
For the diagnosis method to be used at the agriculture site, simplicity of the working process, inexpensiveness and reliability is required. Several monitoring methods for the LAMP products have been reported: magnesium pyrophosphate turbidity, measurement of fluorescence using intercalating fluorescent dyes, and color change using a visualization indicator. For the method of measurement of fluorescence, a transilluminator is needed. It cannot be simply used in the field. Turbidity and color change are the practical ways that we can observe the reaction changes by naked eye during the LAMP assay without extra equipment and time. In addition, turbidity allowed to use in the LAMP assay with the data recording by a loopamp real-time turbidimeter.
100
Primer design is the most important and difficult step among the LAMP assay. In this study, the species-specific LAMP primer sets of Py. irregulare, Py. spinosum, Py.
uncinulatum, Ph. pseudolactucae and Ph. colocasiae were designed from ITS, ITS, ITS, cox1 and Ypt1 regions, respectively. The rDNA–ITS region has most commonly been used for identification of oomycetes to the species level. The ITS sequences in oomycetes can easy to amplify for DNA sequencing in most species with PCR reaction (White et al.
1990; Ristaino et al. 1998). Although Lévesque and de Cock (2004) suggested that the database of ITS sequences can facilitate the identification of Pythium species, there are also some species showing the extremely similar ITS sequences (Kroon et al. 2004). The coxI is recognized as an extremely useful region for accurate species identification (Hebert et al. 2004; Ward et al. 2005; Hajibabaei et al. 2006; Seifert et al. 2007), and also has been proven to be useful for phylogenetic studies of Phytophthora (Martin and Tooley 2003; Kroon et al. 2004). But coxI is a GC-low sequences, so it relatively difficult to design primers. In addition, the ras-related protein (Ypt1) gene that contains alternate conserved and variable regions is highly variable in almost all Phytophthora species (Schena et al. 2006). Hence, these three DNA regions could be as the effective targets for the design of species-specific LAMP primers for many oomycetes.
The reaction temperature has a great influence on the specificity and sensitivity of the LAMP. A series of temperature gradients were conformed to decide the optimum temperature for LAMP reaction of each pathogens. There are nonspecific reactions happened in the specificity test of Py. irregulare and Py. spinosum at the low temperature of 63℃. The amplification of LAMP appeared different speed. In most cases, the lower temperature could accelerate the reaction, however, the opposite result presented in the reaction of Py. uncinulatum specific primer set. These results suggested that the higher
101
temperature can reduce nonspecific reactions, although it has an influence on the reaction speed. Moreover, for different primer sets, the effect generated by temperature changes may be completely opposite. Usually, for the practical application in the field, a temperature error may occur easily in some simple facilities like water bath. Therefore, the selection of optimum temperature should avoid the critical point for the specificity. In this study, the second-best ones were choosed as the optimum temperature for each primer sets.
LAMP method was used into diagnosis of the plant-pathogenic oomycetes in several plants of tomato, eustoma, lettuce and taro. Two LAMP-based procedures of Plant-LAMP and Plant Culture-LAMP were used for diagnosis of the pathogens in plant samples.
Overall, the Plant Culture-LAMP has a little better sensitivity than Plant-LAMP. However, the culture media and a 1-5 extra days needed for Plant Culture-LAMP. Although, as long as the pathogen existed in the testing samples, the pathogen can grow largely in the media for easily detection with LAMP, the case that a multiple oomycetes coexists simultaneously in diseased tissues, the pathogens with slowly growth would to be difficult to isolate and detect with Plant Culture-LAMP. For Plant-LAMP, a big limitation is the pathogens quantity in the testing tissues. The misdiagnosis could be occurred due to the small amount of pathogens. Furthermore, some treatments such as heat treatment to the pre-reaction DNA mixture should be needed to consider for avoiding effects of some ingredient(s) in tissues. Another procedure of Plant Extraction-LAMP also has a good sensitivity detection, but it need a higher extra cost. In this study, we found Plant-LAMP is the best procedure in diagnosis of the pathogens in plants for its simplicity and reliability. The bait-based and DNA extraction-based methods were used for diagnosis of the pathogens in soil samples. We found that for the pathogens with considerable rate of
102
growth and zoospore formation, the bait-based method is better for its simplicity and low costs. In the diagnosis of the pathogens in nutrient solution, the Membrane culture-LAMP was used, and the results indicated that it could be the reliable method for monitoring the pathogens in hydroponic culture systems.
In conclusion, LAMP primer sets were designed for specific detection of the five plant-pathogenic oomycetes, with high detection sensitivity. LAMP-based methods can be effectively used for the diagnosis of pathogenic oomycetes in fields and hydroponic culture systems. The methods had greatly enhanced the management and prevention of diseases for tomato, eustoma, lettuce cultivation.
103
SUMMARY
Plant pathogenic oomycetes are globally distributed and can be considered to be one of the most pathogens, particularly in the species of Pythium which usually cause seed, stem and root rot, and seedling damping-off in various crops, and Phytophthora which usually cause extensive damage to economically important crops such as potatoes, tomatoes, peppers, soybeans, and some natural plant communities. Because most of oomycetes can spread rapidly through water, the cultivations of many crops in the fields or hydroponic culture systems have high risks of plant diseases. In order to effectively control these diseases, prevention of the invasion of the pathogens into cultivation facilities and detection of pathogens before diseases occur are extremely important to develop rapid diagnostic methods of the pathogens.
Pythium and Phytophthora species can be isolated and detected using selective media containing antibacterial and antifungal agents. However, this approach cannot distinguish between pathogenic and nonpathogenic Pythium and Phytophthora species that could be present in the same field. It is also difficult to isolate pathogens that grow more slowly than other species of the same genus using these media. Many studies have assessed the use of molecular methods for the initial and rapid detection of fungi, viruses, and other microorganisms, including Pythium and Phytophthora. Common approaches are conventional and real-time PCR. However, the techniques are time-consuming and require expensive specialized equipment that is usually only used in the laboratory. Since the loop-mediated isothermal amplification (LAMP) method was first developed by Notomi et al. (2000), it has been widely used as an alternative to PCR due to its rapidity, simplicity, and practicality. Although the reaction has high specificity and unlike PCR, it
104
can be performed at a constant temperature. Amplification can be visually observed or measured using the turbidity of the reaction mixture, or by using color indicators.
Moreover, the LAMP reaction is effective even with crude template DNA. Therefore, LAMP is applicable to field diagnoses using only a simple water bath or heat block. In this study, we developed the simple detection methods of some pathogenic oomycetes from field samples using the LAMP and investigated the ecology of the oomycetes in eustoma, tomato, lettuce and taro cultivation fields.
Pythium irregulare is an important soil-borne pathogen that causes seed, stem and root rot, and seedling damping-off in various crops. Here, we have developed a rapid and reliable method for detecting the pathogen using LAMP with primers designed from the sequences of the Py. irregulare ribosomal DNA internal transcribed spacer region. The specificity of the primers for Py. irregulare was tested using 50 isolates of 40 Pythium species, 11 Phytophthora isolates and 8 isolates of 7 other soil-borne pathogens. The assay showed that the limit of sensitivity of the LAMP method was 100 fg of pure DNA, a similar level to that of PCR. LAMP detected Py. irregulare from the supernatant after mixing culture medium (template DNA source) with distilled water. Similarly, positive results were obtained using a Plant-LAMP method applied to a suspension rotted roots in water. A Bait-LAMP method using the supernatant of autoclaved perilla seeds as bait material incubated in a soil/water mixture for 1 week at 25◦C successfully detected Py.
irregulare from the soil. The LAMP assay described in this study is therefore a simple and effective way for practical detection of Py. irregulare.
Hydroponic culture systems are subject to high risks of diseases caused by zoosporic plant pathogens. Control is generally difficult because of the rapid spread of zoospores in the nutrient solutions. Tomato, which are cultivated using the D-tray production system,