ʁ΃ʆ ʭŌ

M. megachiliensis'erythritolɊƓ(VaVƆʃ%69̫čȩ̇"ʭ7:9

"7ʁ1ɾ!(ER̭«Ŀ'Dz̞ 6*Ƿʳˣǟ=ɚɖ" Įī̲Ü 'ˣǟtG†€ɊƓ̽"̭«ĿɔɅ'ɜ͈% Ǯ˧

3'@BZSBw=Ǔ9ER̭«Ŀ'Ė̔Įī̲Ü=::ˣǟʚ ǢER1̭«Ŀ"ER2̭«Ŀ!(STRE͆ļx]Gd„7::ʐ-2 kbp

%1ER3̭«Ŀ!(͆ļx]Gd„68-148 bp"-80 bp%2STREŀ Ħ VaVƆʃ%͈Œ 9STRE(͆ļx]Gd„7-100 bp

-600 bp'͇%ȰĦ 9"Ĵ (48)STRE'ƹĴ"68ŷV

aVƆʃ%͈Œ9 (49)ſ ER3̭«Ŀ3'@BZSBw'!

Ǒ3VaVƆʃ%ŷ͈Œ 9!;" 6*ER1̭«ĿER2

̭«ĿĄ*ER3̭«Ŀ!(ɔɅƤïɒ$9"ɪĝ:/cDNA

!'ER̭«Ŀ'ɜďƊ(ER1̭«Ŀ"ER2̭«Ŀ!97 %ER1̭«Ŀ/(

ER2̭«Ŀ"ER3̭«Ŀ!(76%=ɪER1̭«Ŀ"ER2̭«Ŀ(ͩ®Ɗ

͸"ɢ7: (37)Ė̔Įī̲Ü'ˣǟʚǢ7Ė̔Įī̲Ü 3ͩ® 9"ɨ˲!'2ER1̭«Ŀ"ER2̭«Ŀ(ɔɅ Ƥï3̵ʔŁɖǷʳ3ͩ® 9"ƫŅ:$ ER̭«Ŀ'3'@

BZSBw(͛:¯ʧ%8::L~V[†=ŹƓ $ Ė̔Įī̲Ü=ˣǟʚǢ73'ER̭«Ŀ'ER3̭«ĿǑ3

VaVƆʃ%Ķ͈Œ 9ċʳƊŷ/"=Ĉ0 Ú7 60 Ú͇/!'Ȅ̎ɖɣnj͇ 20% glucose 'Ș̚ĥ=́˄ glycerol 6*

erythritol'ɊƓ̽"Real Time PCR=Ɍ:7̭«Ŀ'ɔɅ̽ˣǟ=˕

tG†€'ɊƓ̽%͈ 2% glucoseǜ¦Š"20% glucoseǜ¦Š=Ȅ, 9"İëɃ( erythritol 'ǂ͸ɊƓ̽'3'( glycerol 'ǂĴ ɊƓ: /ɔɅ̽%͈ (:'ER̭«Ŀ!3ɔɅ̽'IJ ó˟7:$'%ŎGPD1̭«Ŀ!(ʐ60 Á3'İë˟7:

:7'"6860Ú¤Ò% 9VaVƆʃ%Ŏ (ÊÌɖ%glycerol

=ɊƓ 9"ʭ7:'ʚǢ=Ĉǁ% M. megachiliensis

( erythritol =ɊƓ9'Ǣ ̫čȩ̇" ɊƓ 9'"

'˵ͧɊM. megachiliensis(erythritol"Ñ%glycerol3ɊƓ9 (14) Ķ̽%ɊƓ=͆ļ9njǔ%͈ (lj7%$ ($!

erythritol'ɊƓ͆ļnjǔ% Ǯ˧ʚǢĪͱ͆ļŽ36nj͇¤͌'Ȅ̎

ɖ̈́nj͇Ž%Ķ̽%ɊƓ=ļ29"Þlj/ER̭«Ŀ'ɔɅ̽=

ˣǟʚǢER3 ̭«Ŀ'ɔɅ̽( 24 nj͇¤͌%İë /2%

"20% glucoseǜ¦Š!'24nj͇ĪͱʚǢ=Ȅ̎9"20% glucoseǜ¦Š'

ǂerythritol 'ɊƓ̽Ĵerythritol Ș̚ĥVaV%6 ɊƓ9

"ņ˭::7'ʚǢ( ER ̭«Ŀ erythritol ɊƓ%͈Œ 9

"=˭lj93'!39Ⱦ%ER3 ̭«Ŀ(̭«Ŀ‰'͆ļx]Gd„‰

ȕĩ% STRE 2 ŀĦ 9"ɔɅ̽Ķİë":%

¬ erythritol 'ˇ²Òˌɸİë 9"7VaVƆʃ%69

erythritol'ɊƓ%( ER3̭«Ŀ̻˞$Żé=Ɲ 9"ƈ<:9:7

'"7‘%M. megachiliensis(Ș̚ĥ%Ŏ Ŏƹİǿǔ$#ɊʱÝǔȀ

͒!(̫čȩ̇" ‘%glycerol=ɊƓ9͟Ǻǔ%ʽ9%: ž%

erythritol=ɊƓ glycerol%£<9̫čȩ̇" àɌ 9"ʭ7:

ÝǔȀ͒!glycerol=ɊƓ9"(glycerol'ǂglucose7'ɊčƓ%E f€K†=˞ýŰ%ˇ²Ò%ˌɸ9"ċʳ$2"ʭ7:9

̫čȩ̛̇! glycerol 7 erythritol %£<9ɇɎ(‹lj!9/

erythritol(ƚ̷óµɌ=Ǔ 8 (8)¡'ˇ̅ó%$#Ⱦɒ$Ɗ

̇=Ǔ 8 (9)ʖʲÒ!̫čȩ̇" 'ɤij'Ƿʳ=ɔƮ 9 ċʳƊ9¡ˇǨ% 3glycerol'¡mannitol4arabitol$#=̫čȩ

̇" 9ˇ²ŀĦ 8'¶Ú% (ɥɺ˕<:

9ljɨ$ɇɎ(‹lj$ȰĴ (16)ďdz% glycerol " erythritol ( M.

megachiliensis % 9̫čȩ̇"ʭ7:9::#'6$Żé=Ɲ

9'‹lj!8ŸŽǮ˧9ƅ˞9/ER̭«Ŀ'ɔɅ̽

'İë erythritol 'ɊƓ683dž"('ɊƓȀ͒!68ä%¯ʧ9

q „ a † V  „ ̷ ġ ̋ ' G6PDHTKLTAL $ # ' ̵ ʔ 6 * Erythrose-4-phosphate phosphatase (E4PP)'É!erythritol 'ä͵²!9

erythrose 'ɊčƓ̈9/!'nj͇ţ92"ʭ7:9ſ

:7'̵ʔ3Ș̚ĥƆʃ 9ċʳƊǰ2 ͸"%$9‡ǂ!2%

glucose"͸Ș̚ĥǜ¦Š!$%3<7erythritol=‡Ņ̽ɊƓ

8erythritol ǘˇ'Ș̚ĥVaV%Ŏ9̫čȩ̇!$ċʳƊ3ʭ

7:'2glucoseȮů=260%'glucoseȮů!ĪͱʚǢglucose

Ȯů͸-#erythritol ɊƓ̽Ĵ"68erythritol (ǘˇ'̫čȩ

̇!9"lj7"$/erythritol ɊƓ%( NADPH ƅ˞!

9"7̷ó̮Ëi~„V'˶ʆ3͈Œ 9"ʭ7:9/

͟Ǻǔ/!Īͱnj'2% glucoseǜ¦Š!36nj͇¤͌Īħ'glucose ǣȠ 9%3͈<7 erythritol 'ɊƓ˕<: "7ȯʔȧ"

$9³7'̃ˎȽ̇ˇ²Ò%ˌɸ: 9ċʳƊɪĝ:

S. cerevisiae=ɌɒɵɔɅ!(S. cerevisiae BY4741Ǩ"'GCY1̭«Ŀ ǸƯǨ%ER1̭«ĿER2̭«ĿER3̭«Ŀ'::=ŷáɔɅER 'Ƿʳˣǟ=˕ŷáɔɅǨ"̼ɊǨ=Īͱˇ²Ò'ʎÚǟ=˕

";glycerol"erythritol':3ɊƓʳ%IJó(-">#$/

8ERS. cerevisiae'ʎ£˺%͈Œ$"ER̭«Ŀ"GCY1̭«

Ŀ"!(ǷʳĶɒ$9"ʭ7:$7̭«Ŀ'ɔɅ

̽"ƜÙ̵ʔ'ȔƊ'ʚǢ7ˇ²ER=̍Ôʬˬ 9"lj7!

:7'"68S. cerevisiae(ˣʎʏ 6*q„a†V„̷ġ̋

=Ǔ 8erythrose-4-phosphate /!(ɊƓċʳ!9:¤͌'

erythritol=ɊƓ92'̵ʔ!9 E4PP "ER =Ǔ $2ER ̭

«Ŀ'0=őÎ 3erythritol'ä͵²!9erythroseŀĦʚǢ"

erythritolɊƓ!$"ʭ7:9/8M. megachiliensis%

9erythritolɊƓ(erythrose-4-phosphate ¤͌'£˺ʙ̋'ȾɒƊ%8ER̭

«Ŀ(¡'ɊȽ!(˟7:$Ⱦǽ$̵ʔ!9"7S. cerevisiae=Ɍ ɒɵɔɅ%69Ƿʳˣǟ( E4PP 'ˣǟ˕<: $Ʌȿ!(͜"

ʭ7::/!M. megachiliensis'6%q„a†V„̷ġ̋LJɘ Ⱦǽ$£˺ʙ̋=Ǔ9y`€ɊȽ(˟ $!ŸŽ'ɥ

ɺ'̠Ś'2%(M. megachiliensisʼ²'ER̭«Ŀ'ǸƯǨ9(ŷ áɔɅǨ=µÙ Ƿʳˣǟ=˕ƅ˞9ɅȿM. megachiliensis(̭

«ĿőÎʏɨɽ: 7Ƿʳˣǟ'͕̋"$ 92őÎʏ=

ɨɽ Ƿʳˣǟ=˕96%9"ƅͥ!9

Table. 1. Oligonucleotide primers used in this study.

Primer sequence (5’&3’)

ER1.2-for ttggaacaaccgccacgct

ER1.2-rev tcaaccaagtcgaccagac

ER3-for atccccctgaacgacggtaa

ER3- rev ggatttggtcttacccgttt

dT-15-primer ttttttttttttttt

ER1.2-RT-for cgctattgtggatgctgctaag

ER1.2-RT-rev atccgtgagggtgtaactgac

ER3-RT-for ccagaaggttacggatttgat

ER3-RT-rev tcccaaactgaactcaaaggt

GPD1-RT-for ctcttacattcatcttcctgccc

GPD1-RT-rev gggggtaacaggctttgcaattc

GAPDH-RT-for caagggtggtgccaagaaggt

GAPDH-RT-rev ccttggggtcgtacgattcg

ER1.2-XbaI-for ttttttctagatgtcctacaacaagaacat ER1.2-SacI-rev ttttgagctcacattaagcgttaatcttgt ER3-HindIII-for aaaaaagcttgtcaaacaccatgtcttac

ER3-XbaI-rev aaaatctagaggtaggtactgacaataatg

Fig. 3 Plasmid map of pDB05 inserted ER gene

Fig. 4 The structure of the ER1, ER2 and ER3 genes of M. megachiliensis.

Fig. 5 Poyol production and Real-Time PCR of ER gene mRNAs following a short osmotic-stress treatment.

(a) Poyol production, (b) expression of the ER mRNAs was analyzed 30 min after osmotic treatment with 20% glucose. ER1/ER2 gene represents the combined expression of ER1 gene and ER2 gene because these two genes are too similar to analyze individually.

Fig. 6 Analysis of polyol accumulation over after 72-h osmotic-stress treatment.

Fig. 7 Analysis of ER1/ER2 gene, ER3 gene and GPD1 gene expression after 72-h osmotic-stress treatment.

Fig. 8 Polyol production in GY medium containing 2% to 60% glucose for 7days.

Fig. 9 Polyol production by S. cerevisiae BY4741 and transgenic strains.

Fig. 10 Reverse transcription-PCR and erythrose reductase activity of S. cerevisiae transformants harboring pDB05-er3.

Erythrose reductase activity was assayed in a reaction mixture composed of 3 mM erythrose, 5 mM NADPH, 50 mM phosphate buffer of pH 6.5, and crude enzyme preparation extracted from a S. cerevisiae transformant cell in a total volume of 0.1 mL.

(a) Reverse transcription-PCR of mRNA from an er3 transgene inserted into the S.

cerevisiae genome.

(b) Erythrose reductase activity. One unit was defined as 1 $mol of erythritol formed per 1 min per $g of dry cell weight under the condition described above.

ʁ

ʁ 2 ɾ ɾ

Moniliella megachiliensis % % 9 9V Va a V V% %6 69 9

̃

̃ˎ ˎ" "t t G G† †€ €' 'ƫ ƫɳ ɳ

ʁ 1 ʆ ʡ˥

ʁ1ɾ% M. megachiliensis(VaVƆʃ%Ŏ ÝǔȀ͒!(̫čȩ̇"

glycerol =ɊƓ ž% erythritol %£ 8‘9̫čȩ̇(

erythritol!9"=lj7%/'VaVƆʃ%(HOGʙ̋'

͈Œ9"Ĭĕ: 9 (42)Hog ʙ̋%69 glycerol " erythritol '¶Ú'xHdWw"'ɇɎ(lj7%$ $7%ʁ 1 ɾ

% ȯʔȧ" Īħ'glucoseǣȠ %3͈<7erythritol'Ɋ Ɠ˕<: 8M. megachiliensis% ˇ²Ò'ȯʔȧ'̃ˎʭ7:

‡ʿɖ$ƃɊȽ% (̃ˎȽ̇" trehalose4glycogenɢ7:

9 (50, 51, 52) ̵ Ȃ % trehalose ( ˣ ʎ ʏ % 6 Ɋ Ɠ : glucose-6-phosphateTrehalose-6-phosphate synthase (TPS)%6 UDP-glucose

" " 3 % trehalose-6-phosphate % č Ɠ : 7 % Trehalose-6-phosphate phosphatase (TPP)%6 ʵ„̷ó:trehalose"$9 (53)‡ǂtrehalose 'Úˣ( Trehalase (TRE)%6 ˕<: 9 (54)S. cerevisiae !( Neutral trehalase (NTH)"Acid trehalase (ATH)'2ɵͩŀĦ::ɒ$9ǷʳƊ

=Ɲ 9 (55)trehalose(glucoseďı'!-1, 1ʚč%6 DzƓ:

8ʚǎó"I~Vó'Ɗ̇=Ǔ 9 (56)'2̃ˎʎ" 'Ż é'¡%VaVƆʃ" '̫čȩ̇" 3ɢ7: 8[„jL'

¾˿4ͫě% 9¾ŀæ" 'Ƿʳ3Ǔ 9 (57, 58)̵Ȃ4ǭȽ!(

̫čȩ̇" 'Ƿʳ3Ĭĕ: 8”ȹ4Õ×$#'VaV%Ŏ

trehalose=ˌɸ9"!VaVʯƊđ‰9"'ĬĕŀĦ9 (59, 60)

glycogen(glucoseƹĴ̟$Dz̞= 9'ʚč'-">#

!-1, 4ʚč!8̱Úɖ%!-1, 6ʚč%6 DzƓ: 9 (61)ɊȽɵ4

'Ɉįǜ¦%6 ̻čůɒ$9ǭȽ'̃ˎʎ!9starch%Ȅ,9"

!-1, 6 ʚč%69ÚŝĴ$ 9Ȱ!ɒ$9 (62)' glycogen (

Glycogen synthase%6 glucose̓­̈́:Glycogen phosphorylase%6 Úˣ:9;63Ϳ̵ȂͬͲȿƑ%͏9"glycogen' glucose=͓njÚˣ °ÚĿó "ɢ7: 9 (64)'trehalose " glycogen

%(Ƚ͇̇p€!'͈»ƊŀĦglucose 7DzƓ: 9"čƓ '͖%ŽʮUDP-glucose=Ɍ9"Ƥ7:9/čƓ"Úˣ%(cAMP

¹ŀĨProtein kinase A͈Œ 9"4trehalose-6-phosphateˣʎʏ'

Hexokinase '͊ň=˕ 9"Ĭĕ39 (65)7%(fw|V

H(”ȹȿƑ!(trehalose=ˌɸȆÚ=ɂƀ ġƂ9͖%(trehalose 7̃ˎȽ̇= glycogen %IJƭ9"ɢ7: 9 (66)'6%

trehalose £˺" glycogen £˺ˣʎʏ$#'¡'£˺ʙ̋%3źͣ=Ą.

9"ʭ7:9M. megachiliensis% (glycerol"erythritol¤ij' ʎ@€P†€ɊƓ: 9"Ĭĕ($$7:7'̃

ˎȽ̇'£˺ʙ̋ erythritol ɊƓ=Ē1£˺ʙ̋%źͣ=Ą. 9"

ʭ7:

M. megachiliensis'glycerol"erythritol'¶Ú%͈ ʁ1ɾ% 2%

glucoseǜ¦Š"°Ș̚ĥǜ¦Š!3erythritolɊƓ:'(ĪͱŽǔ

%Ɋ̷óVaV%693'"ƫŅ:̷óVaV(Ĺȅɖǜ¦Š

!'Ef€K†ɂƀ'͖%Ɋ9superoxide radical4hydroxyl radical$#ROS

(reactive oxygen species)%6 DNA $#\x†U=Ĉ9": 9

(67)̜ŧROS(Superoxide dismutase4Catalase%6 șĂ:9 (68)

̷óVaV%Ŏ 3̵Ȃ=Ɍɥɺ!̫čȩ̇'ɊƓĬĕ:

9 (69)

ǘɥɺ!(M. megachiliensis̃ˎ 9Ƚ̇% ǮÙ=˕glycerol

"erythritolɊƓ'͈Œ=Ē2Żé% Ǯ˧/glycerol"erythritol '̫čȩ̇" '¶Ú%͈ 3Ǯ˧

ʁ 2 ʆ ņͷǚƾ 6*ǂȐ

1 ņͷǚƾ 6*ˮˏ…ǷĠ ʁ1ɾ ʁ2ʆ 1%Ȩ9

΁ Moniliella megachiliensis'ˇ²Īͱ 2-1 ̃ˎȽ̇ǮÙ'ȱ'Īͱ

ʁ1ɾ ʁ2ʆ 2-2%Ȩ9

2-2 ̃ˎʎ"tG†€ɊƓ'͈»Ɗ%͈9Īͱ

M. megachiliensis=2% glucose=Ē1GYĪħ!200 rpm30˚C'ǜ¦Š!24 nj͇Īͱ˔Ɇ˦ʄə=Ɍ ˇƹ=˦ȥŽ%͙ˇ=˕'Ž

ǁ2% glucoseĪħ":%ʗȮů0.1 mM menadione%$96%˶˚

Īħ40% glucose =Ē1Īħ%͙ˇˇ²=ǁ$Īħ%ɳnj

1.0"10⁷ cell/mL%$96%::ɳǑĶ4nj͇/!Īͱ

2-3 ̃ˎʎˌɸnj"ǖˌɸnj'Īͱ

̃ˎʎˌɸnj'ˇ²'Īͱǜ¦(ǘʆ2-2'ǜ¦"ď!9ǖˌɸnj'ˇ

²(M. megachiliensis=2% glucose=Ē1GYĪħ!200 rpm30˚C'ǜ¦Š!

12nj͇Īͱ˔Ɇ˦ʄə=Ɍ ˇƹ=˦ȥŽ%͙ˇ=˕'Ž

ǁ2% glucoseĪħ":%ʗȮů0.1 mM menadione%$96%˶˚

Īħ40% glucose =Ē1Īħ%͙ˇˇ²=ǁ$Īħ%ɳnj

1.0"10⁷ cell/mL%$96%::ɳ1nj͇Īͱ

3 ˇ²ÒtG†€'ƜÙ"ȥŅȐ 3-1 ˇ²ÒtG†€'ƜÙ"ȥŅ

ʁ1ɾ ʁ2ʆ 4-14-2%Ȩ94-1!˕̪ƄÚ͛Ž'‰ȟġĆ

̽=˩'Ǿȣ(glycogenȥŅ'2'ˮƾ" Ɍ

3-2 glycogen'ȥŅ

glycogen'ȥŅȐ(DŽɢ'ǂȐ=ăʭ%˕ (70)3-1!ɊǾţ%Ŏ

10 N NaOH=200 $Lë ƒȭ20Ú͇ȶȍÕþŽ2 N HCl=1

mLë ĚglycogenƜÙȚ"'ƜÙȚ200 $L=1 M acetate buffer (pH 5.5) 200 $L@v~†YȩȚ [10 mg/mL !-Amylase (Amano Enzyme): 10 mg/mL "-Amylase (Amano Enzyme): 10 mg/mL Glucoamylase (Amano Enzyme)= 8:

1: 1] 1 $L̉ʒȆ599 $L=ë60˚C!16nj͇ąƆ glycogen=glucose

%ÚˣŎ̀" R„o€=@v~†YȩȚ!Úˣ $õÚ"

@v~†YȩȚɎǝ'ÚˣɋȽ=ǮÙ9õÚ=µƓ:7ąƆȚ=

ICS-3000 (DIONEX, Osaka, Japan)L‚uaM~mA†=Ɍ ȥŅR„o

€=25 $LőÎ100 mM NaOH%68ȩ͛H~w(Carbo Pac PA-1

(DIONEX)=Ɍȕ̝(1.0 mL/min'ǜ¦!j€Vb@„q‚xaǮÙĠ

(ED-50̾͝ǰ) (DIONEX)!ǮÙǴȨȚ" 10 $M20 $M'ȩȚ=

ȥŅ™ȰǮ̽Ȑ%6 ȮůǖɢȩȚ'ȥŅ=˕

΃ Moniliella megachiliensis7'RNAƜÙ"cDNAčƓ ʁ1ɾ ʁ2ʆ ΄%Ȩ9

΄ Moniliella megachiliensisb~maOgwT†N„V7'Ǯʕ

b~maOgwT†N„V=Dzʈ¡ˇǨ'µƓȐ=ăʭ% M.

megachiliensis 'b~maOgwT†N„V=Dzʈ (71)M. megachiliensis 'b~maOgwT†N„V(ôȗ̧TV_w…RBE„VǨųªɬ%Ľ˨

Roche Genome Sequencer FLX%69ˣǟ7ƀĮī̲ÜƍĬ'ɜďƊ

Ǯ ʕ % ( NCBI ; National Center for Biotechnology Information;

http://www.ncbi.nlm.nih.gov/Ϳ=ʙɎ BLASTǮʕ=˕Įī̲Ü'ˣǟ (̭«ƍĬØɇZmaCD@ GENETYX-Mac NETWORK version 15. 0. 6

;GENETYX CORPORATIONͿ%68˕

NCBI.fasta'Ogw`†[†p†V%Ŏ Ustilagoś$#DŽɢ'ƝĿˇʏ

̵Ȃ 6*Saccharomycesś=Ɍ `†[†p†V'ÓDzʈ=˕

'`†[=Ɍ M. megachiliensis 'b~maOgwT†N„V'@g_†T }„=˕7%S. cerevisiae'trehalose£˺̵͈̟ʔTPS1 (NP_009684.1) TPS2 (NP_010359.1) TPS3 (NP_013988.1) NTH1 (NP_010284.1) NTH2 (NP_009555.1)ATH1 (NP_015351.1)'@vg̷̲Ü"ɜďƊ=Ƣcontig'Ʃ ʕ=ƀ7:contig= NCBI' BLASTX!ǮʕM. megachiliensis '

trehalose£˺͈̟̭«Ŀ'Ʃʕ=˕

΅ Semi-quantitative RT-PCRȐ%69ɔɅ̽ˣǟ

Go Taq DNA Polymerase (Promega)=Ɍ RT-PCR=˕Ɍo~Bu

†(Trehalase 1 (TRE1)̭«Ŀ 6*Trehalase 2 (TRE2)̭«ĿTRE-RT-for"

TRE-RT-revTrehalose-6-phosphate synthase 1 (TPS1)̭«Ŀ TPS1-RT-for "

TPS1-RT-revTrehalose-6-phosphate synthase 2 (TPS2)̭«Ŀ TPS2-RT-for "

TPS2-RT-revTrehalose-6-phosphate phosphatase 1 (TPP1)̭«ĿTPP1-RT-for"

TPP1-RT-revTrehalose-6-phosphate phosphatase 2 (TPP2)̭«ĿTPP2-RT-for"

TPP2-RT-revGAPDH̭«ĿGAPDH-RT-for"GAPDH-RT-rev=Ɍ̲Ü

(Table 2%˩

ʁ 3 ʆ ʚǢ

1 ̃ˎʎ'ǮÙ"ɊƓnj'ȾŅ

BG„L‚uaM~mA†68ǮÙ:L‚uaM~w68ˇ²ƜÙȚ

%glycerol"erythritol¤ij'l†L=ǮÙsorbitoltrehalosemannitol

arabitol$#'ǴȨȚ'_„T}„[Bw7ǮÙ:l†Ltrehalose!

9"</ƜÙȚ=Amylase!ÚˣʚǢglucoseǮÙ :"68glycogen 3̃ˎ 9"<:7ǮÙt

G†€'ʙnjIJó=Fig. 11%ɪtrehalose(12nj͇736nj͇'͇%

ˌɸ: 8İëÇđ(2% glucoseǜ¦Š!320 % glucoseǜ¦Š!3ď

!ɊƓˌɸ̽(ʐ350450 $mol/g wt cell!/glycogen(36 nj͇Īͱnj%20 % glucoseǜ¦Š!ǑĶ250 $mol/g wt cellɜŸ=ǮÙ

2% glucoseǜ¦!24nj͇Īͱnjtrehalose(ĴɊƓ 9¡'t

G†€(-">#ɊƓ $/36 nj͇7 48 nj͇'͇%3 erythritolɊƓ 9‡ǂtrehalose"glycogen(Ȣœ

2 ̃ˎʎ7tG†€+'ƫɳ

24 nj͇Īͱ trehalose =ˌɸˇ²%Ŏ 40% glucose0.1 mM menadione=Ē1Īħ!VaV=́˄ (Fig. 12)'ʚǢtrehalose(Ï 'ǜ¦!ʐ1/5/!Ȣœ ‡ǂglycerol(40% glucoseǜ¦Š% 2

nj͇!ʐ7Á%‰Lj0.1 mM menadioneǜ¦Š% 1nj͇Ž%ʐ4Á/!%‰

Ljerythritol% 3VaV=́˄2'ǜ¦Ñ%İë 8

40% glucoseǜ¦Š% 2nj͇!ʐ3Á0.1 mM menadioneǜ¦Š% 1nj͇!

ʐ11Á/!‰Lj glycerol3erythritol3‡ɿ‰LjŽ7ʣ4%

Ȣœ

:7Īͱnj'ˇȚ=10Áť̺ȭů=ȥŅʚǢVaV=́˄

$ǜ¦!(1nj͇'˳őǔ=ʙŽ%İë40% glucoseǜ¦Š!

(ˇ²'ȭů%IJó-">#$

3 tG†€ɊƓ%Ą.ˌɸ̃ˎʎ'źͣ

trehalose =ˌɸ 9nj" $nj'ˇ²% 40% glucose 6* 0.1

mM menadione =́˄ 'tG†€'Ƥï% ˶,'ʚǢ

trehalose=ˌɸ 9ˇ²!40% glucoseǜ¦Š0.1 mM menadioneǜ¦Š

#7!3glycerol4erythritolͨˊ%ɊƓ: /0.1 mM menadione ǜ¦Š!'erythritol'ɊƓ(40% glucoseǜ¦Š%Ȅ, ʐ4Á͸Úˣ:

trehalose'moleƹ'Ȯů"-.ďʂ'moleƹ=ɊƓ ‡ǂtrehalose

=ˌɸ $ˇ²!' erythritol ɊƓ(-">#$ˌɸnj%ǑĶ'IJó

07:0.1 mM menadioneǜ¦Š% !3È! (Fig. 13)

4 ̃ˎʎčƓ 6*Úˣ͈̟̭«Ŀ'Ʃʕ

OgwT†N„V`†[p†V68trehalose £˺͈̟̭«Ŀ"ƫȥ:9 TRḘ«ĿTPS̭«ĿTPP̭«Ŀ'ƍĬ=::2ƀ

S. cerevisiae'ATH̭«Ŀ"ͩ®9̲ÜŀĦ$:7ƀ7:̭

«Ŀ=::TRE1 ̭«Ŀ (Accession: AB861464)TRE2 ̭«Ŀ (Accession:

AB861465)TPS1 ̭ « Ŀ (Accession: AB861466)TPS2 ̭ « Ŀ (Accession:

AB861467)TPP1 ̭ « Ŀ (Accession: AB861468)TPP2 ̭ « Ŀ (Accession:

AB861469)"::'[„jL̇%ʬˬ:nj'@vg̷̲Ü'ɜď

Ɗ(TRE͇!97.72%TPS͇!66.43%TPP͇!58.27%!Č̭«Ŀ '¡ˇǨ̭«Ŀ"'ɜďƊ=Table 3%ɪ

΄ ̃ˎʎčƓ 6*Úˣ͈̟̭«Ŀ'ɔɅ̽ˣǟ

͟Ǻǔ!9 72 nj͇/!Īͱ 12 nj͇"%͙ˇˇ²% øŅ̽

ɖPCR=˕ (Fig. 14a)$ TRE1̭«Ŀ"TRE2̭«Ŀ(Įī̲Ü'ɜ ďƊ͸2Àß'o~Bu†˪˦!ď̲ÜİŨ9o~Bu

†=˪˦ ˣǟ=˕'ʚǢTPS2 ̭«ĿTPP1 ̭«Ŀ(-.Ņ ŧɖ%ɔɅ ‡ǂ'¡TPS1 ̭«ĿTPP2 ̭«Ŀ(nj͇'ʙ̦"

"3%ɔɅ̽İë

24nj͇Īͱ trehaloseˌɸŽˇ²%VaV=́˄ˇ²%

3ďdz%øŅ̽ɖ PCR =˕ (Fig. 14b)40% glucose " 0.1 mM

menadione=́˄ˇ²!(TPS1̭«Ŀ(VaV=́˄ $ǜ¦

"Ȅ, ɔɅ̽ƙá: TRḘ«ĿTPP1̭«Ŀ(0.1 mM menadione ǜ¦Š!(ž%İë40% glucoseǜ¦Š!(Ýǔ%ƆʃŽ%Ȣœ 8VaV=́˄ $ǜ¦(90Ú=ǑĶ%120Ú!Ȣœ‡ǂ!

TPS2̭«ĿTPP2̭«Ŀ(VaV=́˄ $ǜ¦0.1 mM menadione

ǜ¦Š!(ž%İë40% glucoseǜ¦Š!(Ýǔ%ƆʃŽ%Ȣœ 9

TPS2̭«Ŀ(2% glucoseǜ¦!60Ú=ǑĶ%90Ú!(Ȣœ 9

ドキュメント内 Ș̚ĥʯƊ̵Ȃ Moniliella megachiliensis % 9 VaVƆʃ"tG†€Ɋɋ (ページ 38-64)